\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220799021:

Variant ID: vg1220799021 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20799021
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, T: 0.33, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:


TGTAATTCACAGTTATTTGTCGTGCAAACTCTATATATAATAACGGGCTATAGCTTTTCTGAAGTAAATGCCATAATAAATTCCATTATTTTGAAAAGAT[T/A]
AAGTCTAAACATAAACAACACAGATGTTAATGAAACTACGAGGGGAAAGGAAGAGAGAGGAAGGATGGTGTAGGAGGCGTCGTCATCCTGAAATTCTTAA

Reverse complement sequence

TTAAGAATTTCAGGATGACGACGCCTCCTACACCATCCTTCCTCTCTCTTCCTTTCCCCTCGTAGTTTCATTAACATCTGTGTTGTTTATGTTTAGACTT[A/T]
ATCTTTTCAAAATAATGGAATTTATTATGGCATTTACTTCAGAAAAGCTATAGCCCGTTATTATATATAGAGTTTGCACGACAAATAACTGTGAATTACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.80% 23.10% 0.13% 0.00% NA
All Indica  2759 98.40% 1.50% 0.11% 0.00% NA
All Japonica  1512 36.10% 63.70% 0.20% 0.00% NA
Aus  269 83.60% 16.40% 0.00% 0.00% NA
Indica I  595 98.50% 1.00% 0.50% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.30% 0.00% 0.00% NA
Temperate Japonica  767 7.80% 92.20% 0.00% 0.00% NA
Tropical Japonica  504 77.60% 21.80% 0.60% 0.00% NA
Japonica Intermediate  241 39.40% 60.60% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220799021 T -> A LOC_Os12g34320.1 upstream_gene_variant ; 2328.0bp to feature; MODIFIER silent_mutation Average:37.609; most accessible tissue: Callus, score: 71.839 N N N N
vg1220799021 T -> A LOC_Os12g34320.2 upstream_gene_variant ; 2328.0bp to feature; MODIFIER silent_mutation Average:37.609; most accessible tissue: Callus, score: 71.839 N N N N
vg1220799021 T -> A LOC_Os12g34310.1 downstream_gene_variant ; 338.0bp to feature; MODIFIER silent_mutation Average:37.609; most accessible tissue: Callus, score: 71.839 N N N N
vg1220799021 T -> A LOC_Os12g34310-LOC_Os12g34320 intergenic_region ; MODIFIER silent_mutation Average:37.609; most accessible tissue: Callus, score: 71.839 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220799021 NA 6.68E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 NA 4.78E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 NA 1.83E-43 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 NA 1.58E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 NA 1.42E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 NA 4.44E-16 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 NA 2.20E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 NA 4.08E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 9.98E-33 1.13E-130 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 2.86E-17 2.79E-33 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 NA 1.12E-06 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 NA 6.80E-37 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 NA 1.40E-10 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 NA 2.79E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 NA 3.12E-07 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 NA 3.08E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 NA 5.50E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 NA 6.65E-07 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 NA 1.85E-06 mr1686 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 NA 2.19E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 NA 9.88E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 NA 2.54E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 1.24E-06 NA mr1928 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 9.71E-44 2.23E-158 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 3.26E-19 1.27E-41 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 1.15E-17 7.91E-71 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021 3.93E-12 1.06E-17 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251