Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220799021:

Variant ID: vg1220799021 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20799021
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, T: 0.33, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:

TGTAATTCACAGTTATTTGTCGTGCAAACTCTATATATAATAACGGGCTATAGCTTTTCTGAAGTAAATGCCATAATAAATTCCATTATTTTGAAAAGAT[T/A]
AAGTCTAAACATAAACAACACAGATGTTAATGAAACTACGAGGGGAAAGGAAGAGAGAGGAAGGATGGTGTAGGAGGCGTCGTCATCCTGAAATTCTTAA

Reverse complement sequence

TTAAGAATTTCAGGATGACGACGCCTCCTACACCATCCTTCCTCTCTCTTCCTTTCCCCTCGTAGTTTCATTAACATCTGTGTTGTTTATGTTTAGACTT[A/T]
ATCTTTTCAAAATAATGGAATTTATTATGGCATTTACTTCAGAAAAGCTATAGCCCGTTATTATATATAGAGTTTGCACGACAAATAACTGTGAATTACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.80%	23.10%	0.13%	0.00%	NA
All Indica	2759	98.40%	1.50%	0.11%	0.00%	NA
All Japonica	1512	36.10%	63.70%	0.20%	0.00%	NA
Aus	269	83.60%	16.40%	0.00%	0.00%	NA
Indica I	595	98.50%	1.00%	0.50%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	99.00%	1.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.70%	1.30%	0.00%	0.00%	NA
Temperate Japonica	767	7.80%	92.20%	0.00%	0.00%	NA
Tropical Japonica	504	77.60%	21.80%	0.60%	0.00%	NA
Japonica Intermediate	241	39.40%	60.60%	0.00%	0.00%	NA
VI/Aromatic	96	84.40%	15.60%	0.00%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220799021	T -> A	LOC_Os12g34320.1	upstream_gene_variant ; 2328.0bp to feature; MODIFIER	silent_mutation	Average:37.609; most accessible tissue: Callus, score: 71.839	N	N	N	N
vg1220799021	T -> A	LOC_Os12g34320.2	upstream_gene_variant ; 2328.0bp to feature; MODIFIER	silent_mutation	Average:37.609; most accessible tissue: Callus, score: 71.839	N	N	N	N
vg1220799021	T -> A	LOC_Os12g34310.1	downstream_gene_variant ; 338.0bp to feature; MODIFIER	silent_mutation	Average:37.609; most accessible tissue: Callus, score: 71.839	N	N	N	N
vg1220799021	T -> A	LOC_Os12g34310-LOC_Os12g34320	intergenic_region ; MODIFIER	silent_mutation	Average:37.609; most accessible tissue: Callus, score: 71.839	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220799021	NA	6.68E-07	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	NA	4.78E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	NA	1.83E-43	mr1093	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	NA	1.58E-10	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	NA	1.42E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	NA	4.44E-16	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	NA	2.20E-06	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	NA	4.08E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	9.98E-33	1.13E-130	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	2.86E-17	2.79E-33	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	NA	1.12E-06	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	NA	6.80E-37	mr1435	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	NA	1.40E-10	mr1435	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	NA	2.79E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	NA	3.12E-07	mr1599	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	NA	3.08E-08	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	NA	5.50E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	NA	6.65E-07	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	NA	1.85E-06	mr1686	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	NA	2.19E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	NA	9.88E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	NA	2.54E-08	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	1.24E-06	NA	mr1928	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	9.71E-44	2.23E-158	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	3.26E-19	1.27E-41	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	1.15E-17	7.91E-71	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220799021	3.93E-12	1.06E-17	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251