\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220752532:

Variant ID: vg1220752532 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20752532
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.05, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


GAGACTGTTCAGATATATTATACTAAGAAACGTCCCATCCAATCTTAGTTTTTATATTTTAGGACAGAAGTAGTAGCATGTAGCAACGTACCATCTATAG[T/C]
CATGCATCTCAACCTTGACAAACTGAGAGCAATGCCAAAATAGTAAACAAAATCTCTCAAATGCCACAAGTGTGTTACTTTTACATAATTTTCCCTAGAC

Reverse complement sequence

GTCTAGGGAAAATTATGTAAAAGTAACACACTTGTGGCATTTGAGAGATTTTGTTTACTATTTTGGCATTGCTCTCAGTTTGTCAAGGTTGAGATGCATG[A/G]
CTATAGATGGTACGTTGCTACATGCTACTACTTCTGTCCTAAAATATAAAAACTAAGATTGGATGGGACGTTTCTTAGTATAATATATCTGAACAGTCTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.10% 14.70% 0.59% 60.52% NA
All Indica  2759 2.90% 24.10% 0.72% 72.35% NA
All Japonica  1512 64.80% 1.10% 0.13% 33.93% NA
Aus  269 17.50% 0.40% 1.86% 80.30% NA
Indica I  595 3.70% 3.00% 0.67% 92.61% NA
Indica II  465 4.50% 33.80% 0.00% 61.72% NA
Indica III  913 1.80% 36.70% 0.88% 60.68% NA
Indica Intermediate  786 2.50% 19.60% 1.02% 76.84% NA
Temperate Japonica  767 93.00% 0.40% 0.00% 6.65% NA
Tropical Japonica  504 23.00% 2.80% 0.40% 73.81% NA
Japonica Intermediate  241 62.70% 0.00% 0.00% 37.34% NA
VI/Aromatic  96 4.20% 2.10% 1.04% 92.71% NA
Intermediate  90 34.40% 14.40% 0.00% 51.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220752532 T -> C LOC_Os12g34220.1 upstream_gene_variant ; 397.0bp to feature; MODIFIER silent_mutation Average:13.726; most accessible tissue: Callus, score: 86.615 N N N N
vg1220752532 T -> C LOC_Os12g34230.1 downstream_gene_variant ; 1321.0bp to feature; MODIFIER silent_mutation Average:13.726; most accessible tissue: Callus, score: 86.615 N N N N
vg1220752532 T -> C LOC_Os12g34240.1 downstream_gene_variant ; 4313.0bp to feature; MODIFIER silent_mutation Average:13.726; most accessible tissue: Callus, score: 86.615 N N N N
vg1220752532 T -> C LOC_Os12g34220-LOC_Os12g34230 intergenic_region ; MODIFIER silent_mutation Average:13.726; most accessible tissue: Callus, score: 86.615 N N N N
vg1220752532 T -> DEL N N silent_mutation Average:13.726; most accessible tissue: Callus, score: 86.615 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220752532 NA 1.79E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 NA 1.58E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 NA 2.08E-11 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 NA 7.64E-07 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 NA 3.96E-10 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 NA 9.36E-10 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 NA 3.85E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 1.15E-25 1.95E-106 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 NA 4.62E-07 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 3.45E-19 1.95E-35 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 NA 3.33E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 9.64E-06 6.19E-06 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 NA 3.64E-11 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 NA 1.04E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 NA 2.79E-07 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 NA 5.77E-06 mr1644 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 NA 5.98E-07 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 NA 2.70E-13 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 NA 9.06E-09 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 NA 1.79E-09 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 NA 5.10E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 7.38E-30 4.25E-122 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 5.43E-06 2.24E-09 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 3.95E-22 5.01E-45 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 NA 1.52E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 1.08E-13 3.15E-59 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220752532 7.10E-15 1.33E-19 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251