Variant ID: vg1220407459 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 20407459 |
Reference Allele: A | Alternative Allele: T |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.75, T: 0.25, others allele: 0.00, population size: 65. )
TGTTCTAACATGGCATAGGCATATAACGGTAAACACAATAAACTCATACCTTGCCTTAGCATCCAACAAACGGCGGCTCAAAGATGTGATGTTGTATCCA[A/T]
CGCCATTCATCTCTCTTGATTTCTTCATGAGCATATTAATGTCTTGCCCCCCGAGCAAAATCGGCTTTCTTGATTGCACGATTTCGAAGGTAAGATGGAT
ATCCATCTTACCTTCGAAATCGTGCAATCAAGAAAGCCGATTTTGCTCGGGGGGCAAGACATTAATATGCTCATGAAGAAATCAAGAGAGATGAATGGCG[T/A]
TGGATACAACATCACATCTTTGAGCCGCCGTTTGTTGGATGCTAAGGCAAGGTATGAGTTTATTGTGTTTACCGTTATATGCCTATGCCATGTTAGAACA
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 42.90% | 15.80% | 35.15% | 6.18% | NA |
All Indica | 2759 | 33.70% | 22.70% | 39.18% | 4.49% | NA |
All Japonica | 1512 | 64.90% | 3.30% | 21.49% | 10.32% | NA |
Aus | 269 | 20.10% | 11.20% | 66.91% | 1.86% | NA |
Indica I | 595 | 28.40% | 9.20% | 50.59% | 11.76% | NA |
Indica II | 465 | 40.90% | 25.80% | 31.40% | 1.94% | NA |
Indica III | 913 | 36.90% | 30.90% | 30.34% | 1.86% | NA |
Indica Intermediate | 786 | 29.60% | 21.40% | 45.42% | 3.56% | NA |
Temperate Japonica | 767 | 94.30% | 0.70% | 2.09% | 3.00% | NA |
Tropical Japonica | 504 | 20.20% | 8.10% | 55.95% | 15.67% | NA |
Japonica Intermediate | 241 | 64.70% | 1.70% | 11.20% | 22.41% | NA |
VI/Aromatic | 96 | 11.50% | 32.30% | 51.04% | 5.21% | NA |
Intermediate | 90 | 57.80% | 11.10% | 28.89% | 2.22% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1220407459 | A -> DEL | N | N | silent_mutation | Average:10.572; most accessible tissue: Zhenshan97 root, score: 15.132 | N | N | N | N |
vg1220407459 | A -> T | LOC_Os12g33840.1 | downstream_gene_variant ; 2124.0bp to feature; MODIFIER | silent_mutation | Average:10.572; most accessible tissue: Zhenshan97 root, score: 15.132 | N | N | N | N |
vg1220407459 | A -> T | LOC_Os12g33840-LOC_Os12g33870 | intergenic_region ; MODIFIER | silent_mutation | Average:10.572; most accessible tissue: Zhenshan97 root, score: 15.132 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1220407459 | 9.84E-07 | NA | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1220407459 | 6.44E-09 | 1.68E-17 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1220407459 | 1.37E-08 | NA | mr1334_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1220407459 | 1.84E-10 | 5.94E-22 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1220407459 | 1.35E-09 | 1.09E-13 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |