Variant ID: vg1220380598 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 20380598 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAAATCACAATCTACTAGGCCCGCTTGAGGAATCATCTACTTTCGCGGGGCTTTGTTACGGGCGGCCTTTTTCCTCGCCTAGAAAAACTATTTTTGGCCA[T/C]
TTGAGAAAACAATTTTCGTAGTAGTGGTCGGAGGTCGGTGCGGATTCGAGGTCACACAGGTGCGTGTTTGTAATCAACCTAACCTACGATTTTGCTAGTA
TACTAGCAAAATCGTAGGTTAGGTTGATTACAAACACGCACCTGTGTGACCTCGAATCCGCACCGACCTCCGACCACTACTACGAAAATTGTTTTCTCAA[A/G]
TGGCCAAAAATAGTTTTTCTAGGCGAGGAAAAAGGCCGCCCGTAACAAAGCCCCGCGAAAGTAGATGATTCCTCAAGCGGGCCTAGTAGATTGTGATTTT
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 39.80% | 4.30% | 2.77% | 53.09% | NA |
All Indica | 2759 | 33.90% | 0.80% | 1.96% | 63.43% | NA |
All Japonica | 1512 | 56.00% | 10.70% | 4.30% | 28.97% | NA |
Aus | 269 | 17.10% | 4.80% | 1.49% | 76.58% | NA |
Indica I | 595 | 29.60% | 1.70% | 4.20% | 64.54% | NA |
Indica II | 465 | 41.30% | 0.40% | 1.08% | 57.20% | NA |
Indica III | 913 | 37.70% | 0.70% | 0.33% | 61.34% | NA |
Indica Intermediate | 786 | 28.20% | 0.40% | 2.67% | 68.70% | NA |
Temperate Japonica | 767 | 85.10% | 7.00% | 2.48% | 5.35% | NA |
Tropical Japonica | 504 | 13.70% | 15.10% | 3.97% | 67.26% | NA |
Japonica Intermediate | 241 | 51.90% | 13.30% | 10.79% | 24.07% | NA |
VI/Aromatic | 96 | 11.50% | 2.10% | 3.12% | 83.33% | NA |
Intermediate | 90 | 50.00% | 5.60% | 5.56% | 38.89% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1220380598 | T -> C | LOC_Os12g33780.1 | downstream_gene_variant ; 3341.0bp to feature; MODIFIER | silent_mutation | Average:27.498; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
vg1220380598 | T -> C | LOC_Os12g33780-LOC_Os12g33800 | intergenic_region ; MODIFIER | silent_mutation | Average:27.498; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
vg1220380598 | T -> DEL | N | N | silent_mutation | Average:27.498; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1220380598 | 3.76E-06 | NA | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg1220380598 | NA | 9.92E-08 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg1220380598 | 6.18E-10 | NA | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1220380598 | NA | 1.44E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1220380598 | NA | 7.98E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1220380598 | 1.66E-14 | NA | mr1334_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1220380598 | 2.85E-09 | NA | mr1991_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |