\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220380598:

Variant ID: vg1220380598 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20380598
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAATCACAATCTACTAGGCCCGCTTGAGGAATCATCTACTTTCGCGGGGCTTTGTTACGGGCGGCCTTTTTCCTCGCCTAGAAAAACTATTTTTGGCCA[T/C]
TTGAGAAAACAATTTTCGTAGTAGTGGTCGGAGGTCGGTGCGGATTCGAGGTCACACAGGTGCGTGTTTGTAATCAACCTAACCTACGATTTTGCTAGTA

Reverse complement sequence

TACTAGCAAAATCGTAGGTTAGGTTGATTACAAACACGCACCTGTGTGACCTCGAATCCGCACCGACCTCCGACCACTACTACGAAAATTGTTTTCTCAA[A/G]
TGGCCAAAAATAGTTTTTCTAGGCGAGGAAAAAGGCCGCCCGTAACAAAGCCCCGCGAAAGTAGATGATTCCTCAAGCGGGCCTAGTAGATTGTGATTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.80% 4.30% 2.77% 53.09% NA
All Indica  2759 33.90% 0.80% 1.96% 63.43% NA
All Japonica  1512 56.00% 10.70% 4.30% 28.97% NA
Aus  269 17.10% 4.80% 1.49% 76.58% NA
Indica I  595 29.60% 1.70% 4.20% 64.54% NA
Indica II  465 41.30% 0.40% 1.08% 57.20% NA
Indica III  913 37.70% 0.70% 0.33% 61.34% NA
Indica Intermediate  786 28.20% 0.40% 2.67% 68.70% NA
Temperate Japonica  767 85.10% 7.00% 2.48% 5.35% NA
Tropical Japonica  504 13.70% 15.10% 3.97% 67.26% NA
Japonica Intermediate  241 51.90% 13.30% 10.79% 24.07% NA
VI/Aromatic  96 11.50% 2.10% 3.12% 83.33% NA
Intermediate  90 50.00% 5.60% 5.56% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220380598 T -> C LOC_Os12g33780.1 downstream_gene_variant ; 3341.0bp to feature; MODIFIER silent_mutation Average:27.498; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg1220380598 T -> C LOC_Os12g33780-LOC_Os12g33800 intergenic_region ; MODIFIER silent_mutation Average:27.498; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg1220380598 T -> DEL N N silent_mutation Average:27.498; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220380598 3.76E-06 NA Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1220380598 NA 9.92E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1220380598 6.18E-10 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220380598 NA 1.44E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220380598 NA 7.98E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220380598 1.66E-14 NA mr1334_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220380598 2.85E-09 NA mr1991_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251