\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220271711:

Variant ID: vg1220271711 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20271711
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCTCAAGGTTCCCCTCAGTTGAAATCCGGCTCCCCCAACTACGCATGGTTTGCTTTTGTTTGGCTGAGGTTTGAGGAAGAAGATGCGGCGGAATAGAG[C/A,T]
GAAATGCGGCCTAATCCCCAGAAAAGCTTCGCAAGCATGGATGAAGTTGGCGATGTGGACTATGGAATTGGGATTTAGGTGATGCAAGCTAATCCCATAG

Reverse complement sequence

CTATGGGATTAGCTTGCATCACCTAAATCCCAATTCCATAGTCCACATCGCCAACTTCATCCATGCTTGCGAAGCTTTTCTGGGGATTAGGCCGCATTTC[G/T,A]
CTCTATTCCGCCGCATCTTCTTCCTCAAACCTCAGCCAAACAAAAGCAAACCATGCGTAGTTGGGGGAGCCGGATTTCAACTGAGGGGAACCTTGAGCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 8.10% 4.53% 36.29% T: 0.02%
All Indica  2759 40.10% 10.60% 6.27% 43.02% T: 0.04%
All Japonica  1512 72.20% 0.30% 0.46% 27.05% NA
Aus  269 33.10% 26.40% 8.18% 32.34% NA
Indica I  595 52.90% 20.70% 5.21% 21.18% NA
Indica II  465 29.90% 4.50% 5.59% 60.00% NA
Indica III  913 33.50% 8.80% 7.45% 50.16% T: 0.11%
Indica Intermediate  786 44.00% 8.70% 6.11% 41.22% NA
Temperate Japonica  767 95.30% 0.00% 0.13% 4.56% NA
Tropical Japonica  504 36.50% 0.80% 0.99% 61.71% NA
Japonica Intermediate  241 73.00% 0.40% 0.41% 26.14% NA
VI/Aromatic  96 77.10% 11.50% 7.29% 4.17% NA
Intermediate  90 61.10% 2.20% 5.56% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220271711 C -> DEL LOC_Os12g33560.1 N frameshift_variant Average:16.406; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1220271711 C -> A LOC_Os12g33560.1 missense_variant ; p.Ala114Ser; MODERATE nonsynonymous_codon ; A114S Average:16.406; most accessible tissue: Zhenshan97 panicle, score: 36.038 benign 0.559 DELETERIOUS 0.01
vg1220271711 C -> T LOC_Os12g33560.1 missense_variant ; p.Ala114Thr; MODERATE nonsynonymous_codon ; A114T Average:16.406; most accessible tissue: Zhenshan97 panicle, score: 36.038 benign 0.57 DELETERIOUS 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220271711 NA 2.11E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271711 NA 1.09E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271711 NA 5.96E-07 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271711 NA 1.59E-06 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271711 NA 7.55E-10 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271711 NA 1.21E-08 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271711 NA 6.82E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271711 3.01E-06 4.22E-09 mr1057_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271711 NA 1.27E-06 mr1164_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271711 NA 2.79E-06 mr1283_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271711 NA 1.61E-06 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271711 NA 2.85E-06 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271711 NA 1.04E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271711 8.45E-06 NA mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271711 NA 8.65E-06 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271711 NA 4.84E-06 mr1887_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271711 NA 1.84E-07 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220271711 NA 2.63E-07 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251