Variant ID: vg1220093634 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 20093634 |
Reference Allele: C | Alternative Allele: G |
Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, G: 0.33, others allele: 0.00, population size: 93. )
TAGGTTAACTGTTGTTTAATTTGCTCAAAGAACTGTAGAAAAATAAATACATTGCCAACCTTAGCTCGTCATGTTTGGAGAGGAACACTTGGAGACTTGG[C/G]
TGTTCAACAGAAAAGGGTTTAGAAGTTCATTATATATATATATATATGCTTCTTAATGATTTTCACTACTGCTATTTGGTAACCTTCGTATAAATCGTTC
GAACGATTTATACGAAGGTTACCAAATAGCAGTAGTGAAAATCATTAAGAAGCATATATATATATATATAATGAACTTCTAAACCCTTTTCTGTTGAACA[G/C]
CCAAGTCTCCAAGTGTTCCTCTCCAAACATGACGAGCTAAGGTTGGCAATGTATTTATTTTTCTACAGTTCTTTGAGCAAATTAAACAACAGTTAACCTA
Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 43.70% | 17.20% | 7.72% | 31.40% | NA |
All Indica | 2759 | 38.50% | 12.50% | 9.46% | 39.51% | NA |
All Japonica | 1512 | 60.70% | 13.60% | 4.96% | 20.70% | NA |
Aus | 269 | 14.50% | 75.80% | 5.20% | 4.46% | NA |
Indica I | 595 | 38.70% | 12.10% | 17.65% | 31.60% | NA |
Indica II | 465 | 57.20% | 4.10% | 8.39% | 30.32% | NA |
Indica III | 913 | 24.50% | 14.10% | 2.85% | 58.49% | NA |
Indica Intermediate | 786 | 43.50% | 16.00% | 11.58% | 28.88% | NA |
Temperate Japonica | 767 | 88.90% | 5.70% | 1.69% | 3.65% | NA |
Tropical Japonica | 504 | 22.60% | 19.60% | 9.92% | 47.82% | NA |
Japonica Intermediate | 241 | 50.60% | 26.10% | 4.98% | 18.26% | NA |
VI/Aromatic | 96 | 5.20% | 36.50% | 12.50% | 45.83% | NA |
Intermediate | 90 | 46.70% | 22.20% | 3.33% | 27.78% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1220093634 | C -> DEL | N | N | silent_mutation | Average:40.639; most accessible tissue: Zhenshan97 young leaf, score: 57.78 | N | N | N | N |
vg1220093634 | C -> G | LOC_Os12g33220.1 | upstream_gene_variant ; 180.0bp to feature; MODIFIER | silent_mutation | Average:40.639; most accessible tissue: Zhenshan97 young leaf, score: 57.78 | N | N | N | N |
vg1220093634 | C -> G | LOC_Os12g33210-LOC_Os12g33220 | intergenic_region ; MODIFIER | silent_mutation | Average:40.639; most accessible tissue: Zhenshan97 young leaf, score: 57.78 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1220093634 | 4.57E-09 | NA | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1220093634 | 1.42E-13 | 3.22E-26 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1220093634 | NA | 1.82E-09 | mr1089_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1220093634 | NA | 9.85E-07 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1220093634 | 2.57E-14 | NA | mr1334_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1220093634 | 8.39E-15 | 3.71E-31 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1220093634 | 1.23E-08 | 2.05E-14 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |