\
| Variant ID: vg1220092619 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20092619 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTGTTCCCAACCCCTCTCCCTGGTATTCCACGCGCACGCTTTTCAAACTACTAAACAATGTGTTTTTTGCAAAAAGTTTATATACGAAAGTTGTTTAAAA[A/G]
AATCAAATTGATCCATTTTTTTTTTAAAAAATAGTTAATACTTAATTAATCATGTGCTAATGAACTACTCCGTTTTCTGTGCGGGGAGATGGATTCCCAA
TTGGGAATCCATCTCCCCGCACAGAAAACGGAGTAGTTCATTAGCACATGATTAATTAAGTATTAACTATTTTTTAAAAAAAAAATGGATCAATTTGATT[T/C]
TTTTAAACAACTTTCGTATATAAACTTTTTGCAAAAAACACATTGTTTAGTAGTTTGAAAAGCGTGCGCGTGGAATACCAGGGAGAGGGGTTGGGAACAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.60% | 0.50% | 0.83% | 52.07% | NA |
| All Indica | 2759 | 39.70% | 0.00% | 0.87% | 59.44% | NA |
| All Japonica | 1512 | 59.90% | 1.70% | 0.53% | 37.96% | NA |
| Aus | 269 | 52.40% | 0.00% | 1.49% | 46.10% | NA |
| Indica I | 595 | 39.70% | 0.00% | 1.34% | 58.99% | NA |
| Indica II | 465 | 58.10% | 0.00% | 0.65% | 41.29% | NA |
| Indica III | 913 | 25.50% | 0.00% | 0.66% | 73.82% | NA |
| Indica Intermediate | 786 | 45.30% | 0.00% | 0.89% | 53.82% | NA |
| Temperate Japonica | 767 | 86.60% | 2.30% | 0.52% | 10.56% | NA |
| Tropical Japonica | 504 | 24.20% | 0.20% | 0.79% | 74.80% | NA |
| Japonica Intermediate | 241 | 49.40% | 2.50% | 0.00% | 48.13% | NA |
| VI/Aromatic | 96 | 11.50% | 0.00% | 1.04% | 87.50% | NA |
| Intermediate | 90 | 54.40% | 0.00% | 2.22% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220092619 | A -> DEL | N | N | silent_mutation | Average:49.778; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg1220092619 | A -> G | LOC_Os12g33220.1 | upstream_gene_variant ; 1195.0bp to feature; MODIFIER | silent_mutation | Average:49.778; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg1220092619 | A -> G | LOC_Os12g33210.1 | downstream_gene_variant ; 4507.0bp to feature; MODIFIER | silent_mutation | Average:49.778; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg1220092619 | A -> G | LOC_Os12g33210-LOC_Os12g33220 | intergenic_region ; MODIFIER | silent_mutation | Average:49.778; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220092619 | 1.63E-07 | 1.63E-07 | mr1008 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220092619 | 2.84E-07 | 2.84E-07 | mr1009 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220092619 | 7.18E-06 | 7.18E-06 | mr1065 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220092619 | 1.54E-08 | 1.54E-08 | mr1067 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220092619 | 5.28E-06 | 5.28E-06 | mr1200 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220092619 | 5.10E-06 | NA | mr1211 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220092619 | 8.71E-08 | 8.71E-08 | mr1750 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220092619 | 2.79E-06 | NA | mr1771 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220092619 | 4.92E-07 | 4.92E-07 | mr1855 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |