| Variant ID: vg1220078311 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20078311 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAAATATATGTGGTTTACATTTAAATACAAGAGGTCCTTATATATCTTGCTGCCTGTTTCTGGGTTGGCTCTTTGACATTGGAGCTGGGATTCGTGAACG[A/G]
GTGACAACATGGTGGATTGGCTTGCTGGTTGGCTTGTTGGTTGATTGGTTGGTTTTGTTCTCTTCAATGCGGGAGCTCTACACAGAAGAAAATAGTGAAC
GTTCACTATTTTCTTCTGTGTAGAGCTCCCGCATTGAAGAGAACAAAACCAACCAATCAACCAACAAGCCAACCAGCAAGCCAATCCACCATGTTGTCAC[T/C]
CGTTCACGAATCCCAGCTCCAATGTCAAAGAGCCAACCCAGAAACAGGCAGCAAGATATATAAGGACCTCTTGTATTTAAATGTAAACCACATATATTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.90% | 0.10% | 23.57% | 28.46% | NA |
| All Indica | 2759 | 40.60% | 0.10% | 33.20% | 26.10% | NA |
| All Japonica | 1512 | 61.90% | 0.00% | 6.28% | 31.81% | NA |
| Aus | 269 | 52.00% | 0.70% | 31.23% | 15.99% | NA |
| Indica I | 595 | 41.80% | 0.00% | 13.45% | 44.71% | NA |
| Indica II | 465 | 59.60% | 0.00% | 27.31% | 13.12% | NA |
| Indica III | 913 | 25.00% | 0.20% | 51.81% | 23.00% | NA |
| Indica Intermediate | 786 | 46.70% | 0.00% | 30.03% | 23.28% | NA |
| Temperate Japonica | 767 | 90.00% | 0.00% | 2.22% | 7.82% | NA |
| Tropical Japonica | 504 | 24.40% | 0.00% | 14.09% | 61.51% | NA |
| Japonica Intermediate | 241 | 51.00% | 0.00% | 2.90% | 46.06% | NA |
| VI/Aromatic | 96 | 12.50% | 0.00% | 7.29% | 80.21% | NA |
| Intermediate | 90 | 60.00% | 0.00% | 13.33% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220078311 | A -> DEL | N | N | silent_mutation | Average:30.44; most accessible tissue: Zhenshan97 root, score: 46.166 | N | N | N | N |
| vg1220078311 | A -> G | LOC_Os12g33180.1 | 3_prime_UTR_variant ; 244.0bp to feature; MODIFIER | silent_mutation | Average:30.44; most accessible tissue: Zhenshan97 root, score: 46.166 | N | N | N | N |
| vg1220078311 | A -> G | LOC_Os12g33170.1 | upstream_gene_variant ; 3026.0bp to feature; MODIFIER | silent_mutation | Average:30.44; most accessible tissue: Zhenshan97 root, score: 46.166 | N | N | N | N |
| vg1220078311 | A -> G | LOC_Os12g33194.1 | downstream_gene_variant ; 2077.0bp to feature; MODIFIER | silent_mutation | Average:30.44; most accessible tissue: Zhenshan97 root, score: 46.166 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220078311 | NA | 1.65E-07 | mr1013 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220078311 | NA | 3.52E-06 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220078311 | NA | 2.06E-07 | mr1034 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220078311 | NA | 9.60E-07 | mr1056 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220078311 | NA | 2.81E-06 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |