Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1219830048:

Variant ID: vg1219830048 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19830048
Reference Allele: C	Alternative Allele: T,G
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.37, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TTGCACCAAAAACATTGAACAGGTCTTGCTCGTCGTTTCTTAGAAGGGATCAGAGAAAGTTATGTTATTCTACTGAGTACTTCAAGGCAATGCTTTGTGG[C/T,G]
GAAGCACCGTACCCAAAGTTAACAAAATAATGTGCAATGTTGTGGATAAGAGAGTAGTGGACTTACAATATTTTTGCACGCTTCCAGAACAATACTCCGT

Reverse complement sequence

ACGGAGTATTGTTCTGGAAGCGTGCAAAAATATTGTAAGTCCACTACTCTCTTATCCACAACATTGCACATTATTTTGTTAACTTTGGGTACGGTGCTTC[G/A,C]
CCACAAAGCATTGCCTTGAAGTACTCAGTAGAATAACATAACTTTCTCTGATCCCTTCTAAGAAACGACGAGCAAGACCTGTTCAATGTTTTTGGTGCAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.90%	34.70%	0.36%	0.00%	G: 0.06%
All Indica	2759	91.30%	8.60%	0.07%	0.00%	NA
All Japonica	1512	21.60%	77.30%	0.86%	0.00%	G: 0.20%
Aus	269	65.40%	34.60%	0.00%	0.00%	NA
Indica I	595	96.10%	3.70%	0.17%	0.00%	NA
Indica II	465	96.10%	3.90%	0.00%	0.00%	NA
Indica III	913	90.80%	9.20%	0.00%	0.00%	NA
Indica Intermediate	786	85.40%	14.50%	0.13%	0.00%	NA
Temperate Japonica	767	31.70%	66.60%	1.69%	0.00%	NA
Tropical Japonica	504	4.40%	95.60%	0.00%	0.00%	NA
Japonica Intermediate	241	25.70%	73.00%	0.00%	0.00%	G: 1.24%
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	40.00%	57.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219830048	C -> G	LOC_Os12g32810.1	upstream_gene_variant ; 3421.0bp to feature; MODIFIER	silent_mutation	Average:62.436; most accessible tissue: Callus, score: 89.676	N	N	N	N
vg1219830048	C -> G	LOC_Os12g32820.1	downstream_gene_variant ; 2678.0bp to feature; MODIFIER	silent_mutation	Average:62.436; most accessible tissue: Callus, score: 89.676	N	N	N	N
vg1219830048	C -> G	LOC_Os12g32820.2	downstream_gene_variant ; 3657.0bp to feature; MODIFIER	silent_mutation	Average:62.436; most accessible tissue: Callus, score: 89.676	N	N	N	N
vg1219830048	C -> G	LOC_Os12g32814.1	intron_variant ; MODIFIER	silent_mutation	Average:62.436; most accessible tissue: Callus, score: 89.676	N	N	N	N
vg1219830048	C -> T	LOC_Os12g32810.1	upstream_gene_variant ; 3421.0bp to feature; MODIFIER	silent_mutation	Average:62.436; most accessible tissue: Callus, score: 89.676	N	N	N	N
vg1219830048	C -> T	LOC_Os12g32820.1	downstream_gene_variant ; 2678.0bp to feature; MODIFIER	silent_mutation	Average:62.436; most accessible tissue: Callus, score: 89.676	N	N	N	N
vg1219830048	C -> T	LOC_Os12g32820.2	downstream_gene_variant ; 3657.0bp to feature; MODIFIER	silent_mutation	Average:62.436; most accessible tissue: Callus, score: 89.676	N	N	N	N
vg1219830048	C -> T	LOC_Os12g32814.1	intron_variant ; MODIFIER	silent_mutation	Average:62.436; most accessible tissue: Callus, score: 89.676	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219830048	NA	2.96E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	7.87E-11	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	4.94E-10	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	1.13E-09	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	4.13E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	9.23E-07	NA	mr1403_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	6.77E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	2.37E-08	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	4.92E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	7.49E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	1.47E-14	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	1.86E-06	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	7.30E-09	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	3.31E-12	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	7.81E-13	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	5.88E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	1.08E-11	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	2.45E-13	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	3.14E-09	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	9.20E-10	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	5.99E-07	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	1.07E-06	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	2.47E-14	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	8.88E-06	1.12E-08	mr1781_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	3.28E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	3.55E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048	NA	2.81E-08	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251