\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219830048:

Variant ID: vg1219830048 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19830048
Reference Allele: CAlternative Allele: T,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.37, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCACCAAAAACATTGAACAGGTCTTGCTCGTCGTTTCTTAGAAGGGATCAGAGAAAGTTATGTTATTCTACTGAGTACTTCAAGGCAATGCTTTGTGG[C/T,G]
GAAGCACCGTACCCAAAGTTAACAAAATAATGTGCAATGTTGTGGATAAGAGAGTAGTGGACTTACAATATTTTTGCACGCTTCCAGAACAATACTCCGT

Reverse complement sequence

ACGGAGTATTGTTCTGGAAGCGTGCAAAAATATTGTAAGTCCACTACTCTCTTATCCACAACATTGCACATTATTTTGTTAACTTTGGGTACGGTGCTTC[G/A,C]
CCACAAAGCATTGCCTTGAAGTACTCAGTAGAATAACATAACTTTCTCTGATCCCTTCTAAGAAACGACGAGCAAGACCTGTTCAATGTTTTTGGTGCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.90% 34.70% 0.36% 0.00% G: 0.06%
All Indica  2759 91.30% 8.60% 0.07% 0.00% NA
All Japonica  1512 21.60% 77.30% 0.86% 0.00% G: 0.20%
Aus  269 65.40% 34.60% 0.00% 0.00% NA
Indica I  595 96.10% 3.70% 0.17% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 90.80% 9.20% 0.00% 0.00% NA
Indica Intermediate  786 85.40% 14.50% 0.13% 0.00% NA
Temperate Japonica  767 31.70% 66.60% 1.69% 0.00% NA
Tropical Japonica  504 4.40% 95.60% 0.00% 0.00% NA
Japonica Intermediate  241 25.70% 73.00% 0.00% 0.00% G: 1.24%
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 40.00% 57.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219830048 C -> G LOC_Os12g32810.1 upstream_gene_variant ; 3421.0bp to feature; MODIFIER silent_mutation Average:62.436; most accessible tissue: Callus, score: 89.676 N N N N
vg1219830048 C -> G LOC_Os12g32820.1 downstream_gene_variant ; 2678.0bp to feature; MODIFIER silent_mutation Average:62.436; most accessible tissue: Callus, score: 89.676 N N N N
vg1219830048 C -> G LOC_Os12g32820.2 downstream_gene_variant ; 3657.0bp to feature; MODIFIER silent_mutation Average:62.436; most accessible tissue: Callus, score: 89.676 N N N N
vg1219830048 C -> G LOC_Os12g32814.1 intron_variant ; MODIFIER silent_mutation Average:62.436; most accessible tissue: Callus, score: 89.676 N N N N
vg1219830048 C -> T LOC_Os12g32810.1 upstream_gene_variant ; 3421.0bp to feature; MODIFIER silent_mutation Average:62.436; most accessible tissue: Callus, score: 89.676 N N N N
vg1219830048 C -> T LOC_Os12g32820.1 downstream_gene_variant ; 2678.0bp to feature; MODIFIER silent_mutation Average:62.436; most accessible tissue: Callus, score: 89.676 N N N N
vg1219830048 C -> T LOC_Os12g32820.2 downstream_gene_variant ; 3657.0bp to feature; MODIFIER silent_mutation Average:62.436; most accessible tissue: Callus, score: 89.676 N N N N
vg1219830048 C -> T LOC_Os12g32814.1 intron_variant ; MODIFIER silent_mutation Average:62.436; most accessible tissue: Callus, score: 89.676 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219830048 NA 2.96E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 7.87E-11 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 4.94E-10 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 1.13E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 4.13E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 9.23E-07 NA mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 6.77E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 2.37E-08 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 4.92E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 7.49E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 1.47E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 1.86E-06 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 7.30E-09 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 3.31E-12 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 7.81E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 5.88E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 1.08E-11 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 2.45E-13 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 3.14E-09 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 9.20E-10 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 5.99E-07 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 1.07E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 2.47E-14 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 8.88E-06 1.12E-08 mr1781_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 3.28E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 3.55E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219830048 NA 2.81E-08 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251