\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219816099:

Variant ID: vg1219816099 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19816099
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, C: 0.14, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AAGACCACGGGGGTCGCTGGGGAGTCCATGCCTTGTTTATAAGGGGGTGATTATAATCTAGGAACGGTGCACTGCTTTGAATTGTATTATGCAGAGGGTA[C/T]
TGTCACAATCTTTATTCGGGTACTTGTTAAGTATCGCGACGCATGGTTGACATGATGTTGAGGTTGTGTCTTGTGGGTACAGTGGTACACCTCTGGCCAG

Reverse complement sequence

CTGGCCAGAGGTGTACCACTGTACCCACAAGACACAACCTCAACATCATGTCAACCATGCGTCGCGATACTTAACAAGTACCCGAATAAAGATTGTGACA[G/A]
TACCCTCTGCATAATACAATTCAAAGCAGTGCACCGTTCCTAGATTATAATCACCCCCTTATAAACAAGGCATGGACTCCCCAGCGACCCCCGTGGTCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.60% 4.40% 2.86% 58.19% NA
All Indica  2759 6.60% 4.10% 3.26% 86.08% NA
All Japonica  1512 86.20% 0.30% 0.13% 13.36% NA
Aus  269 4.80% 29.40% 14.50% 51.30% NA
Indica I  595 7.60% 0.30% 1.68% 90.42% NA
Indica II  465 5.60% 0.40% 1.72% 92.26% NA
Indica III  913 3.40% 6.50% 3.50% 86.64% NA
Indica Intermediate  786 10.20% 6.20% 5.09% 78.50% NA
Temperate Japonica  767 82.80% 0.00% 0.13% 17.08% NA
Tropical Japonica  504 95.80% 0.40% 0.00% 3.77% NA
Japonica Intermediate  241 77.20% 0.80% 0.41% 21.58% NA
VI/Aromatic  96 84.40% 6.20% 0.00% 9.38% NA
Intermediate  90 61.10% 5.60% 4.44% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219816099 C -> DEL N N silent_mutation Average:12.514; most accessible tissue: Zhenshan97 flower, score: 16.6 N N N N
vg1219816099 C -> T LOC_Os12g32800.1 intron_variant ; MODIFIER silent_mutation Average:12.514; most accessible tissue: Zhenshan97 flower, score: 16.6 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219816099 NA 6.38E-07 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816099 2.96E-06 NA mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816099 1.48E-06 NA mr1141_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816099 NA 3.18E-06 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816099 NA 4.14E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816099 NA 2.11E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816099 NA 1.99E-09 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251