\
| Variant ID: vg1219816099 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19816099 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, C: 0.14, others allele: 0.00, population size: 86. )
AAGACCACGGGGGTCGCTGGGGAGTCCATGCCTTGTTTATAAGGGGGTGATTATAATCTAGGAACGGTGCACTGCTTTGAATTGTATTATGCAGAGGGTA[C/T]
TGTCACAATCTTTATTCGGGTACTTGTTAAGTATCGCGACGCATGGTTGACATGATGTTGAGGTTGTGTCTTGTGGGTACAGTGGTACACCTCTGGCCAG
CTGGCCAGAGGTGTACCACTGTACCCACAAGACACAACCTCAACATCATGTCAACCATGCGTCGCGATACTTAACAAGTACCCGAATAAAGATTGTGACA[G/A]
TACCCTCTGCATAATACAATTCAAAGCAGTGCACCGTTCCTAGATTATAATCACCCCCTTATAAACAAGGCATGGACTCCCCAGCGACCCCCGTGGTCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.60% | 4.40% | 2.86% | 58.19% | NA |
| All Indica | 2759 | 6.60% | 4.10% | 3.26% | 86.08% | NA |
| All Japonica | 1512 | 86.20% | 0.30% | 0.13% | 13.36% | NA |
| Aus | 269 | 4.80% | 29.40% | 14.50% | 51.30% | NA |
| Indica I | 595 | 7.60% | 0.30% | 1.68% | 90.42% | NA |
| Indica II | 465 | 5.60% | 0.40% | 1.72% | 92.26% | NA |
| Indica III | 913 | 3.40% | 6.50% | 3.50% | 86.64% | NA |
| Indica Intermediate | 786 | 10.20% | 6.20% | 5.09% | 78.50% | NA |
| Temperate Japonica | 767 | 82.80% | 0.00% | 0.13% | 17.08% | NA |
| Tropical Japonica | 504 | 95.80% | 0.40% | 0.00% | 3.77% | NA |
| Japonica Intermediate | 241 | 77.20% | 0.80% | 0.41% | 21.58% | NA |
| VI/Aromatic | 96 | 84.40% | 6.20% | 0.00% | 9.38% | NA |
| Intermediate | 90 | 61.10% | 5.60% | 4.44% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219816099 | C -> DEL | N | N | silent_mutation | Average:12.514; most accessible tissue: Zhenshan97 flower, score: 16.6 | N | N | N | N |
| vg1219816099 | C -> T | LOC_Os12g32800.1 | intron_variant ; MODIFIER | silent_mutation | Average:12.514; most accessible tissue: Zhenshan97 flower, score: 16.6 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219816099 | NA | 6.38E-07 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219816099 | 2.96E-06 | NA | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219816099 | 1.48E-06 | NA | mr1141_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219816099 | NA | 3.18E-06 | mr1265_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219816099 | NA | 4.14E-08 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219816099 | NA | 2.11E-06 | mr1528_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219816099 | NA | 1.99E-09 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |