\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219794221:

Variant ID: vg1219794221 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19794221
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


TAACTCACAATCAAACTTTTCCATGTTATGCAAAAACCTTGCTATGAGGTCGTAGTCTTCATGTAAAAGGCCACAATGGGCACACTTGCGAGCACGGCGG[C/T]
GAGCTTGGAAGCATGCTTCTCCGAAGACGCCGCCAGCATGGAATGTGCCGCAGCGAGGACATTGCACCACCTCGACGGAGTCCGGCGCCACCTCGACGGA

Reverse complement sequence

TCCGTCGAGGTGGCGCCGGACTCCGTCGAGGTGGTGCAATGTCCTCGCTGCGGCACATTCCATGCTGGCGGCGTCTTCGGAGAAGCATGCTTCCAAGCTC[G/A]
CCGCCGTGCTCGCAAGTGTGCCCATTGTGGCCTTTTACATGAAGACTACGACCTCATAGCAAGGTTTTTGCATAACATGGAAAAGTTTGATTGTGAGTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.50% 25.10% 6.98% 7.45% NA
All Indica  2759 45.30% 36.70% 5.91% 12.11% NA
All Japonica  1512 86.80% 1.60% 10.78% 0.79% NA
Aus  269 51.70% 48.30% 0.00% 0.00% NA
Indica I  595 65.20% 33.90% 0.50% 0.34% NA
Indica II  465 10.30% 43.70% 9.68% 36.34% NA
Indica III  913 53.30% 33.50% 6.35% 6.79% NA
Indica Intermediate  786 41.60% 38.30% 7.25% 12.85% NA
Temperate Japonica  767 81.50% 0.80% 16.95% 0.78% NA
Tropical Japonica  504 96.80% 2.80% 0.20% 0.20% NA
Japonica Intermediate  241 83.00% 1.70% 13.28% 2.07% NA
VI/Aromatic  96 91.70% 6.20% 2.08% 0.00% NA
Intermediate  90 75.60% 15.60% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219794221 C -> DEL N N silent_mutation Average:31.948; most accessible tissue: Zhenshan97 flower, score: 52.901 N N N N
vg1219794221 C -> T LOC_Os12g32760.1 upstream_gene_variant ; 2738.0bp to feature; MODIFIER silent_mutation Average:31.948; most accessible tissue: Zhenshan97 flower, score: 52.901 N N N N
vg1219794221 C -> T LOC_Os12g32770.1 downstream_gene_variant ; 130.0bp to feature; MODIFIER silent_mutation Average:31.948; most accessible tissue: Zhenshan97 flower, score: 52.901 N N N N
vg1219794221 C -> T LOC_Os12g32770-LOC_Os12g32790 intergenic_region ; MODIFIER silent_mutation Average:31.948; most accessible tissue: Zhenshan97 flower, score: 52.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219794221 NA 1.21E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219794221 8.17E-06 NA mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219794221 NA 6.19E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219794221 NA 8.75E-09 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219794221 NA 5.41E-08 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219794221 NA 4.49E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219794221 NA 2.40E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219794221 NA 1.23E-06 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219794221 NA 6.27E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219794221 NA 4.03E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219794221 NA 1.36E-11 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219794221 NA 2.84E-10 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219794221 NA 1.24E-08 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219794221 NA 2.86E-08 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219794221 NA 1.69E-09 mr1992_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251