Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219778717:

Variant ID: vg1219778717 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19778717
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:

CGCGATGCTCTTACAAGTACTCTTTTCGTCCCATTTTAAATGCAGTCATGAGTATTTCCGTGTCTAATATTTGACCAGTCATGAGTATTTCCGTGTCTAA[T/C]
ATTTGACCGTCTGTCTTATTTTAAAAAAATATGACTTTTTTAAAAAAAATAAGTCACGCATAAAGTACTATCTATGTTGTTATTATAATGACAATAAAAA

Reverse complement sequence

TTTTTATTGTCATTATAATAACAACATAGATAGTACTTTATGCGTGACTTATTTTTTTTAAAAAAGTCATATTTTTTTAAAATAAGACAGACGGTCAAAT[A/G]
TTAGACACGGAAATACTCATGACTGGTCAAATATTAGACACGGAAATACTCATGACTGCATTTAAAATGGGACGAAAAGAGTACTTGTAAGAGCATCGCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.00%	24.40%	13.67%	28.97%	NA
All Indica	2759	5.20%	37.20%	13.23%	44.36%	NA
All Japonica	1512	84.50%	1.40%	9.06%	5.03%	NA
Aus	269	1.90%	33.10%	45.72%	19.33%	NA
Indica I	595	5.50%	31.90%	14.29%	48.24%	NA
Indica II	465	4.90%	33.10%	13.55%	48.39%	NA
Indica III	913	2.30%	45.30%	10.95%	41.40%	NA
Indica Intermediate	786	8.40%	34.20%	14.89%	42.49%	NA
Temperate Japonica	767	79.90%	0.90%	13.04%	6.13%	NA
Tropical Japonica	504	95.40%	1.40%	0.99%	2.18%	NA
Japonica Intermediate	241	76.30%	2.90%	13.28%	7.47%	NA
VI/Aromatic	96	81.20%	4.20%	8.33%	6.25%	NA
Intermediate	90	60.00%	13.30%	14.44%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219778717	T -> C	LOC_Os12g32740.1	upstream_gene_variant ; 1304.0bp to feature; MODIFIER	silent_mutation	Average:45.237; most accessible tissue: Callus, score: 81.553	N	N	N	N
vg1219778717	T -> C	LOC_Os12g32750.1	upstream_gene_variant ; 788.0bp to feature; MODIFIER	silent_mutation	Average:45.237; most accessible tissue: Callus, score: 81.553	N	N	N	N
vg1219778717	T -> C	LOC_Os12g32740-LOC_Os12g32750	intergenic_region ; MODIFIER	silent_mutation	Average:45.237; most accessible tissue: Callus, score: 81.553	N	N	N	N
vg1219778717	T -> DEL	N	N	silent_mutation	Average:45.237; most accessible tissue: Callus, score: 81.553	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219778717	NA	6.21E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	8.15E-06	NA	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	1.06E-20	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	4.23E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	2.03E-10	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	2.94E-12	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	6.79E-30	mr1105_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	8.90E-13	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	1.23E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	3.70E-10	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	1.77E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	3.49E-09	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	6.48E-21	mr1239_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	4.35E-09	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	4.58E-06	6.92E-10	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	9.63E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	4.14E-06	NA	mr1403_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	7.14E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	4.62E-07	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	4.26E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	1.15E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	6.18E-13	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	2.02E-12	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	8.87E-13	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	1.87E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	1.23E-08	4.25E-13	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	3.67E-06	3.67E-06	mr1681_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	1.08E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	4.26E-13	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	1.14E-06	mr1781_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	7.50E-10	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	6.30E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	9.19E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	5.63E-06	5.63E-06	mr1914_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	5.26E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	5.14E-21	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219778717	NA	1.31E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251