\
| Variant ID: vg1219748144 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19748144 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 72. )
AAACAAAACATCCATTCAGGATAAGAACCTAGGTAAGTAAATATGCAACAGTTGAGGTGGAACTGGTTTCTTAAATAAACCATAGAAGTAGCATTGCATT[T/A]
TTTAATAAACTTGCCAGATATGAACTCAACCAAGTCAGATATGCCATTAACAAACCTACATAGCCATTAACAAACAAACGCCAAACATTAATTTCCTGAT
ATCAGGAAATTAATGTTTGGCGTTTGTTTGTTAATGGCTATGTAGGTTTGTTAATGGCATATCTGACTTGGTTGAGTTCATATCTGGCAAGTTTATTAAA[A/T]
AATGCAATGCTACTTCTATGGTTTATTTAAGAAACCAGTTCCACCTCAACTGTTGCATATTTACTTACCTAGGTTCTTATCCTGAATGGATGTTTTGTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.50% | 33.50% | 1.71% | 18.30% | NA |
| All Indica | 2759 | 19.00% | 49.90% | 2.57% | 28.45% | NA |
| All Japonica | 1512 | 96.80% | 1.20% | 0.26% | 1.72% | NA |
| Aus | 269 | 24.50% | 63.20% | 1.86% | 10.41% | NA |
| Indica I | 595 | 6.60% | 71.60% | 2.52% | 19.33% | NA |
| Indica II | 465 | 6.90% | 54.60% | 2.80% | 35.70% | NA |
| Indica III | 913 | 30.10% | 32.60% | 1.97% | 35.27% | NA |
| Indica Intermediate | 786 | 22.80% | 50.90% | 3.18% | 23.16% | NA |
| Temperate Japonica | 767 | 98.30% | 0.10% | 0.13% | 1.43% | NA |
| Tropical Japonica | 504 | 96.20% | 1.00% | 0.20% | 2.58% | NA |
| Japonica Intermediate | 241 | 93.40% | 5.00% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 78.10% | 7.30% | 0.00% | 14.58% | NA |
| Intermediate | 90 | 74.40% | 11.10% | 1.11% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219748144 | T -> DEL | N | N | silent_mutation | Average:18.714; most accessible tissue: Callus, score: 48.423 | N | N | N | N |
| vg1219748144 | T -> A | LOC_Os12g32700.1 | intron_variant ; MODIFIER | silent_mutation | Average:18.714; most accessible tissue: Callus, score: 48.423 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219748144 | NA | 6.18E-07 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219748144 | NA | 1.76E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219748144 | NA | 1.42E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219748144 | NA | 2.32E-09 | mr1575 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219748144 | NA | 3.64E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219748144 | NA | 4.54E-08 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219748144 | NA | 3.99E-06 | mr1832 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219748144 | NA | 4.04E-06 | mr1884 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219748144 | NA | 2.09E-06 | mr1992 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219748144 | NA | 3.21E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219748144 | 7.82E-06 | NA | mr1269_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219748144 | 9.22E-06 | NA | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219748144 | NA | 6.89E-06 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |