Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1219745123:

Variant ID: vg1219745123 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19745123
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:

AGATAGGGCAGAGGAGGCATCACAGGTCTGGTTTGGATTAAATTTAATGTTGCACTTTGTATAGATATATGCAGTTTCAATTTCATCTTCTGTTTTCTAC[C/A]
ACCTCGCAATGTGACAGTTGGTATGAGGAGATCTCATCAAAGTTCACTGATTTTTTATATTGTTCAAACATCTAATTCAGCCTTTGTAGTAAATGTACCT

Reverse complement sequence

AGGTACATTTACTACAAAGGCTGAATTAGATGTTTGAACAATATAAAAAATCAGTGAACTTTGATGAGATCTCCTCATACCAACTGTCACATTGCGAGGT[G/T]
GTAGAAAACAGAAGATGAAATTGAAACTGCATATATCTATACAAAGTGCAACATTAAATTTAATCCAAACCAGACCTGTGATGCCTCCTCTGCCCTATCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.90%	33.30%	2.09%	16.67%	NA
All Indica	2759	20.60%	49.80%	2.97%	26.64%	NA
All Japonica	1512	96.90%	1.20%	0.07%	1.85%	NA
Aus	269	28.30%	62.50%	5.58%	3.72%	NA
Indica I	595	7.90%	71.40%	1.85%	18.82%	NA
Indica II	465	8.20%	54.40%	1.08%	36.34%	NA
Indica III	913	32.30%	32.50%	5.26%	29.90%	NA
Indica Intermediate	786	24.00%	50.60%	2.29%	23.03%	NA
Temperate Japonica	767	98.30%	0.10%	0.13%	1.43%	NA
Tropical Japonica	504	96.20%	1.00%	0.00%	2.78%	NA
Japonica Intermediate	241	93.80%	5.00%	0.00%	1.24%	NA
VI/Aromatic	96	87.50%	7.30%	0.00%	5.21%	NA
Intermediate	90	76.70%	11.10%	1.11%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219745123	C -> DEL	N	N	silent_mutation	Average:15.465; most accessible tissue: Callus, score: 37.925	N	N	N	N
vg1219745123	C -> A	LOC_Os12g32690.1	upstream_gene_variant ; 2002.0bp to feature; MODIFIER	silent_mutation	Average:15.465; most accessible tissue: Callus, score: 37.925	N	N	N	N
vg1219745123	C -> A	LOC_Os12g32700.1	downstream_gene_variant ; 2701.0bp to feature; MODIFIER	silent_mutation	Average:15.465; most accessible tissue: Callus, score: 37.925	N	N	N	N
vg1219745123	C -> A	LOC_Os12g32690-LOC_Os12g32700	intergenic_region ; MODIFIER	silent_mutation	Average:15.465; most accessible tissue: Callus, score: 37.925	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219745123	NA	3.12E-09	mr1151	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219745123	NA	8.23E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219745123	NA	3.21E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219745123	NA	2.20E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219745123	NA	1.98E-06	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219745123	NA	8.86E-10	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219745123	NA	1.89E-09	mr1575	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219745123	NA	3.29E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219745123	NA	5.38E-06	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219745123	NA	9.61E-06	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251