\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219745123:

Variant ID: vg1219745123 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19745123
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


AGATAGGGCAGAGGAGGCATCACAGGTCTGGTTTGGATTAAATTTAATGTTGCACTTTGTATAGATATATGCAGTTTCAATTTCATCTTCTGTTTTCTAC[C/A]
ACCTCGCAATGTGACAGTTGGTATGAGGAGATCTCATCAAAGTTCACTGATTTTTTATATTGTTCAAACATCTAATTCAGCCTTTGTAGTAAATGTACCT

Reverse complement sequence

AGGTACATTTACTACAAAGGCTGAATTAGATGTTTGAACAATATAAAAAATCAGTGAACTTTGATGAGATCTCCTCATACCAACTGTCACATTGCGAGGT[G/T]
GTAGAAAACAGAAGATGAAATTGAAACTGCATATATCTATACAAAGTGCAACATTAAATTTAATCCAAACCAGACCTGTGATGCCTCCTCTGCCCTATCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.90% 33.30% 2.09% 16.67% NA
All Indica  2759 20.60% 49.80% 2.97% 26.64% NA
All Japonica  1512 96.90% 1.20% 0.07% 1.85% NA
Aus  269 28.30% 62.50% 5.58% 3.72% NA
Indica I  595 7.90% 71.40% 1.85% 18.82% NA
Indica II  465 8.20% 54.40% 1.08% 36.34% NA
Indica III  913 32.30% 32.50% 5.26% 29.90% NA
Indica Intermediate  786 24.00% 50.60% 2.29% 23.03% NA
Temperate Japonica  767 98.30% 0.10% 0.13% 1.43% NA
Tropical Japonica  504 96.20% 1.00% 0.00% 2.78% NA
Japonica Intermediate  241 93.80% 5.00% 0.00% 1.24% NA
VI/Aromatic  96 87.50% 7.30% 0.00% 5.21% NA
Intermediate  90 76.70% 11.10% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219745123 C -> DEL N N silent_mutation Average:15.465; most accessible tissue: Callus, score: 37.925 N N N N
vg1219745123 C -> A LOC_Os12g32690.1 upstream_gene_variant ; 2002.0bp to feature; MODIFIER silent_mutation Average:15.465; most accessible tissue: Callus, score: 37.925 N N N N
vg1219745123 C -> A LOC_Os12g32700.1 downstream_gene_variant ; 2701.0bp to feature; MODIFIER silent_mutation Average:15.465; most accessible tissue: Callus, score: 37.925 N N N N
vg1219745123 C -> A LOC_Os12g32690-LOC_Os12g32700 intergenic_region ; MODIFIER silent_mutation Average:15.465; most accessible tissue: Callus, score: 37.925 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219745123 NA 3.12E-09 mr1151 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219745123 NA 8.23E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219745123 NA 3.21E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219745123 NA 2.20E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219745123 NA 1.98E-06 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219745123 NA 8.86E-10 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219745123 NA 1.89E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219745123 NA 3.29E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219745123 NA 5.38E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219745123 NA 9.61E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251