| Variant ID: vg1219745123 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19745123 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 73. )
AGATAGGGCAGAGGAGGCATCACAGGTCTGGTTTGGATTAAATTTAATGTTGCACTTTGTATAGATATATGCAGTTTCAATTTCATCTTCTGTTTTCTAC[C/A]
ACCTCGCAATGTGACAGTTGGTATGAGGAGATCTCATCAAAGTTCACTGATTTTTTATATTGTTCAAACATCTAATTCAGCCTTTGTAGTAAATGTACCT
AGGTACATTTACTACAAAGGCTGAATTAGATGTTTGAACAATATAAAAAATCAGTGAACTTTGATGAGATCTCCTCATACCAACTGTCACATTGCGAGGT[G/T]
GTAGAAAACAGAAGATGAAATTGAAACTGCATATATCTATACAAAGTGCAACATTAAATTTAATCCAAACCAGACCTGTGATGCCTCCTCTGCCCTATCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.90% | 33.30% | 2.09% | 16.67% | NA |
| All Indica | 2759 | 20.60% | 49.80% | 2.97% | 26.64% | NA |
| All Japonica | 1512 | 96.90% | 1.20% | 0.07% | 1.85% | NA |
| Aus | 269 | 28.30% | 62.50% | 5.58% | 3.72% | NA |
| Indica I | 595 | 7.90% | 71.40% | 1.85% | 18.82% | NA |
| Indica II | 465 | 8.20% | 54.40% | 1.08% | 36.34% | NA |
| Indica III | 913 | 32.30% | 32.50% | 5.26% | 29.90% | NA |
| Indica Intermediate | 786 | 24.00% | 50.60% | 2.29% | 23.03% | NA |
| Temperate Japonica | 767 | 98.30% | 0.10% | 0.13% | 1.43% | NA |
| Tropical Japonica | 504 | 96.20% | 1.00% | 0.00% | 2.78% | NA |
| Japonica Intermediate | 241 | 93.80% | 5.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 87.50% | 7.30% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 76.70% | 11.10% | 1.11% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219745123 | C -> DEL | N | N | silent_mutation | Average:15.465; most accessible tissue: Callus, score: 37.925 | N | N | N | N |
| vg1219745123 | C -> A | LOC_Os12g32690.1 | upstream_gene_variant ; 2002.0bp to feature; MODIFIER | silent_mutation | Average:15.465; most accessible tissue: Callus, score: 37.925 | N | N | N | N |
| vg1219745123 | C -> A | LOC_Os12g32700.1 | downstream_gene_variant ; 2701.0bp to feature; MODIFIER | silent_mutation | Average:15.465; most accessible tissue: Callus, score: 37.925 | N | N | N | N |
| vg1219745123 | C -> A | LOC_Os12g32690-LOC_Os12g32700 | intergenic_region ; MODIFIER | silent_mutation | Average:15.465; most accessible tissue: Callus, score: 37.925 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219745123 | NA | 3.12E-09 | mr1151 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219745123 | NA | 8.23E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219745123 | NA | 3.21E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219745123 | NA | 2.20E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219745123 | NA | 1.98E-06 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219745123 | NA | 8.86E-10 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219745123 | NA | 1.89E-09 | mr1575 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219745123 | NA | 3.29E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219745123 | NA | 5.38E-06 | mr1832 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219745123 | NA | 9.61E-06 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |