Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219645684:

Variant ID: vg1219645684 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19645684
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

TTCTGAACTTACGATATTTAGCCATTGATTTATGGATTTTCCATTTATCTATGAATGTTTGGGCTCACCATTAATTTGTTTCATTTCAGTGACCCTTATC[T/C]
GTGAAATATTTTTCGCTTCCTCCCACTTTGTTTTCTGCACAATCCATGTGTCGTGGTTGATGCTGGTTAATGGTTGTATTTCCTCTTTTTTATTTTGGGA

Reverse complement sequence

TCCCAAAATAAAAAAGAGGAAATACAACCATTAACCAGCATCAACCACGACACATGGATTGTGCAGAAAACAAAGTGGGAGGAAGCGAAAAATATTTCAC[A/G]
GATAAGGGTCACTGAAATGAAACAAATTAATGGTGAGCCCAAACATTCATAGATAAATGGAAAATCCATAAATCAATGGCTAAATATCGTAAGTTCAGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.20%	33.20%	0.08%	3.45%	NA
All Indica	2759	92.10%	3.30%	0.11%	4.49%	NA
All Japonica	1512	13.10%	84.50%	0.00%	2.45%	NA
Aus	269	72.90%	26.80%	0.37%	0.00%	NA
Indica I	595	96.60%	2.40%	0.00%	1.01%	NA
Indica II	465	80.90%	2.20%	0.65%	16.34%	NA
Indica III	913	96.60%	1.50%	0.00%	1.86%	NA
Indica Intermediate	786	90.10%	6.70%	0.00%	3.18%	NA
Temperate Japonica	767	17.50%	79.30%	0.00%	3.26%	NA
Tropical Japonica	504	3.80%	96.20%	0.00%	0.00%	NA
Japonica Intermediate	241	18.70%	76.30%	0.00%	4.98%	NA
VI/Aromatic	96	20.80%	79.20%	0.00%	0.00%	NA
Intermediate	90	37.80%	60.00%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219645684	T -> C	LOC_Os12g32544.1	5_prime_UTR_variant ; 1430.0bp to feature; MODIFIER	silent_mutation	Average:58.763; most accessible tissue: Minghui63 flower, score: 75.921	N	N	N	N
vg1219645684	T -> DEL	N	N	silent_mutation	Average:58.763; most accessible tissue: Minghui63 flower, score: 75.921	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219645684	7.17E-06	NA	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	3.31E-12	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	7.54E-27	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	1.01E-10	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	1.53E-12	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	7.41E-13	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	6.36E-10	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	6.18E-10	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	1.83E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	2.80E-19	mr1239_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	3.52E-07	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	3.27E-08	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	1.52E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	8.91E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	5.66E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	9.51E-11	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	6.08E-13	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	1.71E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	5.95E-13	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	4.07E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	6.34E-09	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	2.43E-06	7.49E-11	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	2.54E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	1.78E-11	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	5.79E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	3.25E-07	NA	mr1915_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	3.48E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	NA	1.65E-23	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219645684	9.55E-06	9.48E-12	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251