\
| Variant ID: vg1219631829 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19631829 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 100. )
CTCTAACCAATCGCACCACACCTCAGGTTTCACCCCCACTCCTCGCAAGGCAGCGGGCAGTCCCCTCTCGTGCCACGGTGAATCCGGAAGCCGATCAACC[G/A]
GACACCTCGACCGACCCAACTCCATCACGCCCACCCTTGCCTGGGTACGTCGGCTAGAGGAAAGCTATACTACAAGCCCAGTCGTTGCCCACGCTGGCAT
ATGCCAGCGTGGGCAACGACTGGGCTTGTAGTATAGCTTTCCTCTAGCCGACGTACCCAGGCAAGGGTGGGCGTGATGGAGTTGGGTCGGTCGAGGTGTC[C/T]
GGTTGATCGGCTTCCGGATTCACCGTGGCACGAGAGGGGACTGCCCGCTGCCTTGCGAGGAGTGGGGGTGAAACCTGAGGTGTGGTGCGATTGGTTAGAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.80% | 47.10% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 83.40% | 16.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 3.10% | 96.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 41.60% | 58.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 78.70% | 21.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 81.50% | 18.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 79.50% | 20.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.10% | 97.80% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.80% | 94.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 89.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 31.10% | 67.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219631829 | G -> A | LOC_Os12g32530.1 | upstream_gene_variant ; 1283.0bp to feature; MODIFIER | silent_mutation | Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg1219631829 | G -> A | LOC_Os12g32536.1 | upstream_gene_variant ; 2660.0bp to feature; MODIFIER | silent_mutation | Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg1219631829 | G -> A | LOC_Os12g32536.3 | upstream_gene_variant ; 2660.0bp to feature; MODIFIER | silent_mutation | Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg1219631829 | G -> A | LOC_Os12g32536.2 | upstream_gene_variant ; 2660.0bp to feature; MODIFIER | silent_mutation | Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg1219631829 | G -> A | LOC_Os12g32536.4 | upstream_gene_variant ; 2660.0bp to feature; MODIFIER | silent_mutation | Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg1219631829 | G -> A | LOC_Os12g32520.1 | downstream_gene_variant ; 1512.0bp to feature; MODIFIER | silent_mutation | Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg1219631829 | G -> A | LOC_Os12g32520-LOC_Os12g32530 | intergenic_region ; MODIFIER | silent_mutation | Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219631829 | NA | 3.55E-08 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219631829 | NA | 4.97E-10 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219631829 | NA | 1.44E-09 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219631829 | NA | 5.13E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219631829 | NA | 9.83E-09 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219631829 | NA | 7.74E-10 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219631829 | NA | 2.73E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219631829 | NA | 7.03E-07 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219631829 | NA | 1.56E-14 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219631829 | 2.57E-06 | 6.49E-13 | mr1646_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219631829 | 2.36E-06 | 1.12E-06 | mr1646_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219631829 | NA | 3.56E-12 | mr1830_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219631829 | NA | 9.36E-08 | mr1869_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219631829 | NA | 3.58E-07 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219631829 | NA | 2.92E-08 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |