\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219631829:

Variant ID: vg1219631829 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19631829
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTAACCAATCGCACCACACCTCAGGTTTCACCCCCACTCCTCGCAAGGCAGCGGGCAGTCCCCTCTCGTGCCACGGTGAATCCGGAAGCCGATCAACC[G/A]
GACACCTCGACCGACCCAACTCCATCACGCCCACCCTTGCCTGGGTACGTCGGCTAGAGGAAAGCTATACTACAAGCCCAGTCGTTGCCCACGCTGGCAT

Reverse complement sequence

ATGCCAGCGTGGGCAACGACTGGGCTTGTAGTATAGCTTTCCTCTAGCCGACGTACCCAGGCAAGGGTGGGCGTGATGGAGTTGGGTCGGTCGAGGTGTC[C/T]
GGTTGATCGGCTTCCGGATTCACCGTGGCACGAGAGGGGACTGCCCGCTGCCTTGCGAGGAGTGGGGGTGAAACCTGAGGTGTGGTGCGATTGGTTAGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.80% 47.10% 0.06% 0.00% NA
All Indica  2759 83.40% 16.60% 0.04% 0.00% NA
All Japonica  1512 3.10% 96.80% 0.07% 0.00% NA
Aus  269 41.60% 58.40% 0.00% 0.00% NA
Indica I  595 95.00% 5.00% 0.00% 0.00% NA
Indica II  465 78.70% 21.30% 0.00% 0.00% NA
Indica III  913 81.50% 18.40% 0.11% 0.00% NA
Indica Intermediate  786 79.50% 20.50% 0.00% 0.00% NA
Temperate Japonica  767 2.10% 97.80% 0.13% 0.00% NA
Tropical Japonica  504 3.40% 96.60% 0.00% 0.00% NA
Japonica Intermediate  241 5.80% 94.20% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 31.10% 67.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219631829 G -> A LOC_Os12g32530.1 upstream_gene_variant ; 1283.0bp to feature; MODIFIER silent_mutation Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg1219631829 G -> A LOC_Os12g32536.1 upstream_gene_variant ; 2660.0bp to feature; MODIFIER silent_mutation Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg1219631829 G -> A LOC_Os12g32536.3 upstream_gene_variant ; 2660.0bp to feature; MODIFIER silent_mutation Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg1219631829 G -> A LOC_Os12g32536.2 upstream_gene_variant ; 2660.0bp to feature; MODIFIER silent_mutation Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg1219631829 G -> A LOC_Os12g32536.4 upstream_gene_variant ; 2660.0bp to feature; MODIFIER silent_mutation Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg1219631829 G -> A LOC_Os12g32520.1 downstream_gene_variant ; 1512.0bp to feature; MODIFIER silent_mutation Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg1219631829 G -> A LOC_Os12g32520-LOC_Os12g32530 intergenic_region ; MODIFIER silent_mutation Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219631829 NA 3.55E-08 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829 NA 4.97E-10 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829 NA 1.44E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829 NA 5.13E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829 NA 9.83E-09 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829 NA 7.74E-10 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829 NA 2.73E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829 NA 7.03E-07 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829 NA 1.56E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829 2.57E-06 6.49E-13 mr1646_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829 2.36E-06 1.12E-06 mr1646_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829 NA 3.56E-12 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829 NA 9.36E-08 mr1869_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829 NA 3.58E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829 NA 2.92E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251