Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1219631829:

Variant ID: vg1219631829 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19631829
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

CTCTAACCAATCGCACCACACCTCAGGTTTCACCCCCACTCCTCGCAAGGCAGCGGGCAGTCCCCTCTCGTGCCACGGTGAATCCGGAAGCCGATCAACC[G/A]
GACACCTCGACCGACCCAACTCCATCACGCCCACCCTTGCCTGGGTACGTCGGCTAGAGGAAAGCTATACTACAAGCCCAGTCGTTGCCCACGCTGGCAT

Reverse complement sequence

ATGCCAGCGTGGGCAACGACTGGGCTTGTAGTATAGCTTTCCTCTAGCCGACGTACCCAGGCAAGGGTGGGCGTGATGGAGTTGGGTCGGTCGAGGTGTC[C/T]
GGTTGATCGGCTTCCGGATTCACCGTGGCACGAGAGGGGACTGCCCGCTGCCTTGCGAGGAGTGGGGGTGAAACCTGAGGTGTGGTGCGATTGGTTAGAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.80%	47.10%	0.06%	0.00%	NA
All Indica	2759	83.40%	16.60%	0.04%	0.00%	NA
All Japonica	1512	3.10%	96.80%	0.07%	0.00%	NA
Aus	269	41.60%	58.40%	0.00%	0.00%	NA
Indica I	595	95.00%	5.00%	0.00%	0.00%	NA
Indica II	465	78.70%	21.30%	0.00%	0.00%	NA
Indica III	913	81.50%	18.40%	0.11%	0.00%	NA
Indica Intermediate	786	79.50%	20.50%	0.00%	0.00%	NA
Temperate Japonica	767	2.10%	97.80%	0.13%	0.00%	NA
Tropical Japonica	504	3.40%	96.60%	0.00%	0.00%	NA
Japonica Intermediate	241	5.80%	94.20%	0.00%	0.00%	NA
VI/Aromatic	96	10.40%	89.60%	0.00%	0.00%	NA
Intermediate	90	31.10%	67.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219631829	G -> A	LOC_Os12g32530.1	upstream_gene_variant ; 1283.0bp to feature; MODIFIER	silent_mutation	Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg1219631829	G -> A	LOC_Os12g32536.1	upstream_gene_variant ; 2660.0bp to feature; MODIFIER	silent_mutation	Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg1219631829	G -> A	LOC_Os12g32536.3	upstream_gene_variant ; 2660.0bp to feature; MODIFIER	silent_mutation	Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg1219631829	G -> A	LOC_Os12g32536.2	upstream_gene_variant ; 2660.0bp to feature; MODIFIER	silent_mutation	Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg1219631829	G -> A	LOC_Os12g32536.4	upstream_gene_variant ; 2660.0bp to feature; MODIFIER	silent_mutation	Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg1219631829	G -> A	LOC_Os12g32520.1	downstream_gene_variant ; 1512.0bp to feature; MODIFIER	silent_mutation	Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg1219631829	G -> A	LOC_Os12g32520-LOC_Os12g32530	intergenic_region ; MODIFIER	silent_mutation	Average:43.945; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219631829	NA	3.55E-08	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829	NA	4.97E-10	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829	NA	1.44E-09	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829	NA	5.13E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829	NA	9.83E-09	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829	NA	7.74E-10	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829	NA	2.73E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829	NA	7.03E-07	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829	NA	1.56E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829	2.57E-06	6.49E-13	mr1646_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829	2.36E-06	1.12E-06	mr1646_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829	NA	3.56E-12	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829	NA	9.36E-08	mr1869_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829	NA	3.58E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219631829	NA	2.92E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251