Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1219489547:

Variant ID: vg1219489547 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19489547
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, G: 0.10, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


AAGATTTTCATTTTCCTTTTGTTTTTGAGTAAGATAAAGTGCATGAGAGAACTTTTTACATTTATAATATTTTCTACCATCCTGGTACATGGTTCTTTTG[T/G]
TGTACTTTAGGTTCACTTCAGTGCACATTACATCAGACATAAACGAAATAATTGGACTACATGCATCACTGGGAATTGTAGAAGTTACAAAAGGGTATAG

Reverse complement sequence

CTATACCCTTTTGTAACTTCTACAATTCCCAGTGATGCATGTAGTCCAATTATTTCGTTTATGTCTGATGTAATGTGCACTGAAGTGAACCTAAAGTACA[A/C]
CAAAAGAACCATGTACCAGGATGGTAGAAAATATTATAAATGTAAAAAGTTCTCTCATGCACTTTATCTTACTCAAAAACAAAAGGAAAATGAAAATCTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.20% 43.80% 0.02% 0.00% NA
All Indica  2759 32.50% 67.50% 0.04% 0.00% NA
All Japonica  1512 97.80% 2.20% 0.00% 0.00% NA
Aus  269 46.10% 53.90% 0.00% 0.00% NA
Indica I  595 4.00% 95.80% 0.17% 0.00% NA
Indica II  465 74.60% 25.40% 0.00% 0.00% NA
Indica III  913 27.40% 72.60% 0.00% 0.00% NA
Indica Intermediate  786 35.00% 65.00% 0.00% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 96.40% 3.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219489547 T -> G LOC_Os12g32284.1 upstream_gene_variant ; 3614.0bp to feature; MODIFIER silent_mutation Average:45.151; most accessible tissue: Callus, score: 80.627 N N N N
vg1219489547 T -> G LOC_Os12g32280.1 intron_variant ; MODIFIER silent_mutation Average:45.151; most accessible tissue: Callus, score: 80.627 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219489547 NA 8.36E-15 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 5.37E-08 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 1.08E-15 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 7.96E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 4.99E-16 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 7.20E-06 mr1185 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 3.04E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 1.65E-06 mr1269 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 1.03E-10 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 1.85E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 1.45E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 7.50E-07 mr1479 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 4.05E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 4.26E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 3.54E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 1.05E-15 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 3.53E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 1.21E-16 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 1.34E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 7.19E-08 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 8.47E-09 mr1681 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 7.80E-07 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 5.03E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 1.08E-14 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 1.05E-06 mr1975 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219489547 NA 2.89E-16 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251