Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1219449222:

Variant ID: vg1219449222 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19449222
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

CTGCAGCTTTCGTCCCCCTAATATTTGTTGATCTGTTTCCGTCCATATCAAAGCCTGAATATTGTTGTGATACATGCTTGATTTATAGAAGTATACATGT[A/G]
TAATCTAATTCATACGGAACTTCTTTTGGCTAACAGAAATCAGACAATAATTTATATTGAGTCCGTACATCCATATAGATCCTATATCATGTTTGATTTT

Reverse complement sequence

AAAATCAAACATGATATAGGATCTATATGGATGTACGGACTCAATATAAATTATTGTCTGATTTCTGTTAGCCAAAAGAAGTTCCGTATGAATTAGATTA[T/C]
ACATGTATACTTCTATAAATCAAGCATGTATCACAACAATATTCAGGCTTTGATATGGACGGAAACAGATCAACAAATATTAGGGGGACGAAAGCTGCAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.30%	4.30%	0.40%	0.00%	NA
All Indica	2759	92.10%	7.20%	0.69%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	83.00%	15.60%	1.34%	0.00%	NA
Indica II	465	95.90%	3.90%	0.22%	0.00%	NA
Indica III	913	96.60%	3.10%	0.33%	0.00%	NA
Indica Intermediate	786	91.30%	7.80%	0.89%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219449222	A -> G	LOC_Os12g32230.1	upstream_gene_variant ; 2947.0bp to feature; MODIFIER	silent_mutation	Average:34.722; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1219449222	A -> G	LOC_Os12g32230.2	upstream_gene_variant ; 2947.0bp to feature; MODIFIER	silent_mutation	Average:34.722; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1219449222	A -> G	LOC_Os12g32210.1	downstream_gene_variant ; 2026.0bp to feature; MODIFIER	silent_mutation	Average:34.722; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1219449222	A -> G	LOC_Os12g32210-LOC_Os12g32230	intergenic_region ; MODIFIER	silent_mutation	Average:34.722; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219449222	6.00E-08	1.87E-11	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219449222	4.14E-07	3.84E-11	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219449222	6.22E-09	9.89E-13	mr1389	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219449222	1.27E-07	2.24E-11	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219449222	8.72E-09	8.39E-13	mr1038_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219449222	2.10E-08	4.58E-12	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219449222	1.31E-10	1.10E-14	mr1389_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219449222	3.64E-10	1.12E-14	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251