| Variant ID: vg1219449222 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19449222 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 124. )
CTGCAGCTTTCGTCCCCCTAATATTTGTTGATCTGTTTCCGTCCATATCAAAGCCTGAATATTGTTGTGATACATGCTTGATTTATAGAAGTATACATGT[A/G]
TAATCTAATTCATACGGAACTTCTTTTGGCTAACAGAAATCAGACAATAATTTATATTGAGTCCGTACATCCATATAGATCCTATATCATGTTTGATTTT
AAAATCAAACATGATATAGGATCTATATGGATGTACGGACTCAATATAAATTATTGTCTGATTTCTGTTAGCCAAAAGAAGTTCCGTATGAATTAGATTA[T/C]
ACATGTATACTTCTATAAATCAAGCATGTATCACAACAATATTCAGGCTTTGATATGGACGGAAACAGATCAACAAATATTAGGGGGACGAAAGCTGCAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.30% | 4.30% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 92.10% | 7.20% | 0.69% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.00% | 15.60% | 1.34% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 96.60% | 3.10% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 91.30% | 7.80% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219449222 | A -> G | LOC_Os12g32230.1 | upstream_gene_variant ; 2947.0bp to feature; MODIFIER | silent_mutation | Average:34.722; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1219449222 | A -> G | LOC_Os12g32230.2 | upstream_gene_variant ; 2947.0bp to feature; MODIFIER | silent_mutation | Average:34.722; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1219449222 | A -> G | LOC_Os12g32210.1 | downstream_gene_variant ; 2026.0bp to feature; MODIFIER | silent_mutation | Average:34.722; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1219449222 | A -> G | LOC_Os12g32210-LOC_Os12g32230 | intergenic_region ; MODIFIER | silent_mutation | Average:34.722; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219449222 | 6.00E-08 | 1.87E-11 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219449222 | 4.14E-07 | 3.84E-11 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219449222 | 6.22E-09 | 9.89E-13 | mr1389 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219449222 | 1.27E-07 | 2.24E-11 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219449222 | 8.72E-09 | 8.39E-13 | mr1038_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219449222 | 2.10E-08 | 4.58E-12 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219449222 | 1.31E-10 | 1.10E-14 | mr1389_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219449222 | 3.64E-10 | 1.12E-14 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |