\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219449222:

Variant ID: vg1219449222 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19449222
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCAGCTTTCGTCCCCCTAATATTTGTTGATCTGTTTCCGTCCATATCAAAGCCTGAATATTGTTGTGATACATGCTTGATTTATAGAAGTATACATGT[A/G]
TAATCTAATTCATACGGAACTTCTTTTGGCTAACAGAAATCAGACAATAATTTATATTGAGTCCGTACATCCATATAGATCCTATATCATGTTTGATTTT

Reverse complement sequence

AAAATCAAACATGATATAGGATCTATATGGATGTACGGACTCAATATAAATTATTGTCTGATTTCTGTTAGCCAAAAGAAGTTCCGTATGAATTAGATTA[T/C]
ACATGTATACTTCTATAAATCAAGCATGTATCACAACAATATTCAGGCTTTGATATGGACGGAAACAGATCAACAAATATTAGGGGGACGAAAGCTGCAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.30% 4.30% 0.40% 0.00% NA
All Indica  2759 92.10% 7.20% 0.69% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 83.00% 15.60% 1.34% 0.00% NA
Indica II  465 95.90% 3.90% 0.22% 0.00% NA
Indica III  913 96.60% 3.10% 0.33% 0.00% NA
Indica Intermediate  786 91.30% 7.80% 0.89% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219449222 A -> G LOC_Os12g32230.1 upstream_gene_variant ; 2947.0bp to feature; MODIFIER silent_mutation Average:34.722; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1219449222 A -> G LOC_Os12g32230.2 upstream_gene_variant ; 2947.0bp to feature; MODIFIER silent_mutation Average:34.722; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1219449222 A -> G LOC_Os12g32210.1 downstream_gene_variant ; 2026.0bp to feature; MODIFIER silent_mutation Average:34.722; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1219449222 A -> G LOC_Os12g32210-LOC_Os12g32230 intergenic_region ; MODIFIER silent_mutation Average:34.722; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219449222 6.00E-08 1.87E-11 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219449222 4.14E-07 3.84E-11 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219449222 6.22E-09 9.89E-13 mr1389 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219449222 1.27E-07 2.24E-11 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219449222 8.72E-09 8.39E-13 mr1038_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219449222 2.10E-08 4.58E-12 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219449222 1.31E-10 1.10E-14 mr1389_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219449222 3.64E-10 1.12E-14 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251