\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219176479:

Variant ID: vg1219176479 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19176479
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TTCATTGTTAAATATATTTTTATATACGTATATAATTTTACATATTTCACAAAAGTTTTTAATAAAACGAACGGTCAAACATGTGCTAAAAAGTCAACGG[C/T]
GTCAAACATTTCGAAACGGAGGGAGTATACATTTAGATTTTCAGGTGGCGGGCATTGGGTGAAGATCACGGTAGGTACGAATATGAATAATCAAGTGGCA

Reverse complement sequence

TGCCACTTGATTATTCATATTCGTACCTACCGTGATCTTCACCCAATGCCCGCCACCTGAAAATCTAAATGTATACTCCCTCCGTTTCGAAATGTTTGAC[G/A]
CCGTTGACTTTTTAGCACATGTTTGACCGTTCGTTTTATTAAAAACTTTTGTGAAATATGTAAAATTATATACGTATATAAAAATATATTTAACAATGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.40% 16.70% 16.27% 18.66% NA
All Indica  2759 25.60% 17.10% 26.82% 30.52% NA
All Japonica  1512 93.40% 5.80% 0.26% 0.60% NA
Aus  269 11.50% 76.60% 5.20% 6.69% NA
Indica I  595 13.40% 20.30% 37.98% 28.24% NA
Indica II  465 28.40% 22.40% 24.09% 25.16% NA
Indica III  913 30.70% 13.00% 21.14% 35.16% NA
Indica Intermediate  786 27.10% 16.30% 26.59% 30.03% NA
Temperate Japonica  767 98.60% 0.80% 0.13% 0.52% NA
Tropical Japonica  504 94.80% 4.60% 0.40% 0.20% NA
Japonica Intermediate  241 73.90% 24.10% 0.41% 1.66% NA
VI/Aromatic  96 84.40% 9.40% 2.08% 4.17% NA
Intermediate  90 65.60% 14.40% 10.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219176479 C -> DEL N N silent_mutation Average:32.23; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg1219176479 C -> T LOC_Os12g31860.1 downstream_gene_variant ; 4155.0bp to feature; MODIFIER silent_mutation Average:32.23; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg1219176479 C -> T LOC_Os12g31860.3 downstream_gene_variant ; 4155.0bp to feature; MODIFIER silent_mutation Average:32.23; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg1219176479 C -> T LOC_Os12g31860.2 downstream_gene_variant ; 4155.0bp to feature; MODIFIER silent_mutation Average:32.23; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg1219176479 C -> T LOC_Os12g31860.5 downstream_gene_variant ; 4155.0bp to feature; MODIFIER silent_mutation Average:32.23; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg1219176479 C -> T LOC_Os12g31850-LOC_Os12g31860 intergenic_region ; MODIFIER silent_mutation Average:32.23; most accessible tissue: Minghui63 root, score: 71.702 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219176479 4.08E-06 7.68E-06 mr1293_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176479 6.77E-06 2.69E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176479 4.16E-06 5.50E-06 mr1497_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176479 7.41E-06 NA mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176479 NA 7.40E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176479 2.96E-06 NA mr1756_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176479 NA 1.78E-06 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176479 NA 3.51E-06 mr1823_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176479 NA 4.63E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176479 NA 3.62E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176479 NA 7.27E-07 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176479 NA 7.03E-06 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176479 3.29E-06 NA mr1976_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251