| Variant ID: vg1219176479 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19176479 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 104. )
TTCATTGTTAAATATATTTTTATATACGTATATAATTTTACATATTTCACAAAAGTTTTTAATAAAACGAACGGTCAAACATGTGCTAAAAAGTCAACGG[C/T]
GTCAAACATTTCGAAACGGAGGGAGTATACATTTAGATTTTCAGGTGGCGGGCATTGGGTGAAGATCACGGTAGGTACGAATATGAATAATCAAGTGGCA
TGCCACTTGATTATTCATATTCGTACCTACCGTGATCTTCACCCAATGCCCGCCACCTGAAAATCTAAATGTATACTCCCTCCGTTTCGAAATGTTTGAC[G/A]
CCGTTGACTTTTTAGCACATGTTTGACCGTTCGTTTTATTAAAAACTTTTGTGAAATATGTAAAATTATATACGTATATAAAAATATATTTAACAATGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.40% | 16.70% | 16.27% | 18.66% | NA |
| All Indica | 2759 | 25.60% | 17.10% | 26.82% | 30.52% | NA |
| All Japonica | 1512 | 93.40% | 5.80% | 0.26% | 0.60% | NA |
| Aus | 269 | 11.50% | 76.60% | 5.20% | 6.69% | NA |
| Indica I | 595 | 13.40% | 20.30% | 37.98% | 28.24% | NA |
| Indica II | 465 | 28.40% | 22.40% | 24.09% | 25.16% | NA |
| Indica III | 913 | 30.70% | 13.00% | 21.14% | 35.16% | NA |
| Indica Intermediate | 786 | 27.10% | 16.30% | 26.59% | 30.03% | NA |
| Temperate Japonica | 767 | 98.60% | 0.80% | 0.13% | 0.52% | NA |
| Tropical Japonica | 504 | 94.80% | 4.60% | 0.40% | 0.20% | NA |
| Japonica Intermediate | 241 | 73.90% | 24.10% | 0.41% | 1.66% | NA |
| VI/Aromatic | 96 | 84.40% | 9.40% | 2.08% | 4.17% | NA |
| Intermediate | 90 | 65.60% | 14.40% | 10.00% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219176479 | C -> DEL | N | N | silent_mutation | Average:32.23; most accessible tissue: Minghui63 root, score: 71.702 | N | N | N | N |
| vg1219176479 | C -> T | LOC_Os12g31860.1 | downstream_gene_variant ; 4155.0bp to feature; MODIFIER | silent_mutation | Average:32.23; most accessible tissue: Minghui63 root, score: 71.702 | N | N | N | N |
| vg1219176479 | C -> T | LOC_Os12g31860.3 | downstream_gene_variant ; 4155.0bp to feature; MODIFIER | silent_mutation | Average:32.23; most accessible tissue: Minghui63 root, score: 71.702 | N | N | N | N |
| vg1219176479 | C -> T | LOC_Os12g31860.2 | downstream_gene_variant ; 4155.0bp to feature; MODIFIER | silent_mutation | Average:32.23; most accessible tissue: Minghui63 root, score: 71.702 | N | N | N | N |
| vg1219176479 | C -> T | LOC_Os12g31860.5 | downstream_gene_variant ; 4155.0bp to feature; MODIFIER | silent_mutation | Average:32.23; most accessible tissue: Minghui63 root, score: 71.702 | N | N | N | N |
| vg1219176479 | C -> T | LOC_Os12g31850-LOC_Os12g31860 | intergenic_region ; MODIFIER | silent_mutation | Average:32.23; most accessible tissue: Minghui63 root, score: 71.702 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219176479 | 4.08E-06 | 7.68E-06 | mr1293_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219176479 | 6.77E-06 | 2.69E-06 | mr1294_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219176479 | 4.16E-06 | 5.50E-06 | mr1497_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219176479 | 7.41E-06 | NA | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219176479 | NA | 7.40E-06 | mr1729_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219176479 | 2.96E-06 | NA | mr1756_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219176479 | NA | 1.78E-06 | mr1814_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219176479 | NA | 3.51E-06 | mr1823_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219176479 | NA | 4.63E-06 | mr1831_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219176479 | NA | 3.62E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219176479 | NA | 7.27E-07 | mr1856_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219176479 | NA | 7.03E-06 | mr1974_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219176479 | 3.29E-06 | NA | mr1976_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |