\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219155331:

Variant ID: vg1219155331 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19155331
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, T: 0.24, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


AGTCTGCCATTACCATACTGCATTTATCGTGTTTGTATTTGTTCAAATACAATATTCTGAAATTATGTGGAACGAGTGTGTCACAGTATGCCCGTTAAAT[A/T]
TCGTTCTGAGGAATTAATCATCAAACTTTGGCTACAGACCGGCTGTCCACTGGGTTTGCTGTCGCAGATGTAGACTTGTCAAAAGTTGAGGCTGTGCGAA

Reverse complement sequence

TTCGCACAGCCTCAACTTTTGACAAGTCTACATCTGCGACAGCAAACCCAGTGGACAGCCGGTCTGTAGCCAAAGTTTGATGATTAATTCCTCAGAACGA[T/A]
ATTTAACGGGCATACTGTGACACACTCGTTCCACATAATTTCAGAATATTGTATTTGAACAAATACAAACACGATAAATGCAGTATGGTAATGGCAGACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.30% 24.60% 0.04% 0.00% NA
All Indica  2759 66.10% 33.90% 0.07% 0.00% NA
All Japonica  1512 93.60% 6.40% 0.00% 0.00% NA
Aus  269 59.50% 40.50% 0.00% 0.00% NA
Indica I  595 68.90% 31.10% 0.00% 0.00% NA
Indica II  465 80.60% 19.40% 0.00% 0.00% NA
Indica III  913 55.30% 44.60% 0.11% 0.00% NA
Indica Intermediate  786 67.80% 32.10% 0.13% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 95.20% 4.80% 0.00% 0.00% NA
Japonica Intermediate  241 73.40% 26.60% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219155331 A -> T LOC_Os12g31820.1 upstream_gene_variant ; 4376.0bp to feature; MODIFIER silent_mutation Average:65.577; most accessible tissue: Minghui63 flower, score: 78.979 N N N N
vg1219155331 A -> T LOC_Os12g31840.1 upstream_gene_variant ; 2766.0bp to feature; MODIFIER silent_mutation Average:65.577; most accessible tissue: Minghui63 flower, score: 78.979 N N N N
vg1219155331 A -> T LOC_Os12g31830.1 intron_variant ; MODIFIER silent_mutation Average:65.577; most accessible tissue: Minghui63 flower, score: 78.979 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219155331 NA 1.76E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 NA 6.94E-06 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 NA 1.47E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 NA 3.08E-06 mr1157 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 NA 5.83E-06 mr1171 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 NA 6.87E-06 mr1314 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 NA 3.27E-06 mr1374 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 NA 1.23E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 2.20E-06 4.97E-07 mr1413 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 2.97E-06 2.97E-06 mr1413 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 NA 1.23E-07 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 8.81E-06 9.37E-08 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 NA 4.99E-06 mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 NA 2.93E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 NA 1.84E-09 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 NA 4.19E-06 mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 NA 7.70E-09 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 7.78E-06 7.36E-09 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 NA 3.60E-08 mr1642 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 NA 8.54E-06 mr1768 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 3.87E-07 3.18E-07 mr1981 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 NA 1.14E-07 mr1981 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 NA 8.05E-07 mr1989 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219155331 NA 7.77E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251