\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219113826:

Variant ID: vg1219113826 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19113826
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCTACTTCCTCCCTCCCACAAAGGAGATCGTTTTACTGGCTAACAAATATCCTAGAATGGTTGACGTTGTACTCGCCCATCGGCAGTAATAATGGCGC[A/G]
GAAAAGTGGCACCATCTAGGGATGAAAACGGAGCGGATAGTTTCCGTCCGCTCCGGACAAAAATGGATACGGATACCTTTCGGATCAGATAATTCTCGGA

Reverse complement sequence

TCCGAGAATTATCTGATCCGAAAGGTATCCGTATCCATTTTTGTCCGGAGCGGACGGAAACTATCCGCTCCGTTTTCATCCCTAGATGGTGCCACTTTTC[T/C]
GCGCCATTATTACTGCCGATGGGCGAGTACAACGTCAACCATTCTAGGATATTTGTTAGCCAGTAAAACGATCTCCTTTGTGGGAGGGAGGAAGTAGACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.10% 38.40% 6.98% 7.47% NA
All Indica  2759 72.10% 8.90% 11.16% 7.90% NA
All Japonica  1512 2.20% 92.20% 0.73% 4.83% NA
Aus  269 62.10% 14.10% 2.60% 21.19% NA
Indica I  595 71.30% 2.20% 21.34% 5.21% NA
Indica II  465 60.90% 21.10% 9.46% 8.60% NA
Indica III  913 78.40% 4.70% 6.13% 10.73% NA
Indica Intermediate  786 71.90% 11.60% 10.31% 6.23% NA
Temperate Japonica  767 1.20% 97.90% 0.26% 0.65% NA
Tropical Japonica  504 1.20% 94.00% 0.79% 3.97% NA
Japonica Intermediate  241 7.90% 70.10% 2.07% 19.92% NA
VI/Aromatic  96 12.50% 85.40% 0.00% 2.08% NA
Intermediate  90 27.80% 64.40% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219113826 A -> DEL N N silent_mutation Average:44.199; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg1219113826 A -> G LOC_Os12g31748.2 intron_variant ; MODIFIER silent_mutation Average:44.199; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg1219113826 A -> G LOC_Os12g31748.1 intron_variant ; MODIFIER silent_mutation Average:44.199; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219113826 NA 4.95E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826 NA 4.09E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826 NA 4.00E-09 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826 NA 1.36E-20 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826 NA 4.49E-17 mr1361 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826 NA 4.19E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826 NA 1.32E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826 NA 6.84E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826 NA 6.84E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826 NA 3.82E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826 NA 3.48E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826 6.51E-07 NA mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826 NA 6.56E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826 NA 3.53E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251