Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219113826:

Variant ID: vg1219113826 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19113826
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

TGTCTACTTCCTCCCTCCCACAAAGGAGATCGTTTTACTGGCTAACAAATATCCTAGAATGGTTGACGTTGTACTCGCCCATCGGCAGTAATAATGGCGC[A/G]
GAAAAGTGGCACCATCTAGGGATGAAAACGGAGCGGATAGTTTCCGTCCGCTCCGGACAAAAATGGATACGGATACCTTTCGGATCAGATAATTCTCGGA

Reverse complement sequence

TCCGAGAATTATCTGATCCGAAAGGTATCCGTATCCATTTTTGTCCGGAGCGGACGGAAACTATCCGCTCCGTTTTCATCCCTAGATGGTGCCACTTTTC[T/C]
GCGCCATTATTACTGCCGATGGGCGAGTACAACGTCAACCATTCTAGGATATTTGTTAGCCAGTAAAACGATCTCCTTTGTGGGAGGGAGGAAGTAGACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.10%	38.40%	6.98%	7.47%	NA
All Indica	2759	72.10%	8.90%	11.16%	7.90%	NA
All Japonica	1512	2.20%	92.20%	0.73%	4.83%	NA
Aus	269	62.10%	14.10%	2.60%	21.19%	NA
Indica I	595	71.30%	2.20%	21.34%	5.21%	NA
Indica II	465	60.90%	21.10%	9.46%	8.60%	NA
Indica III	913	78.40%	4.70%	6.13%	10.73%	NA
Indica Intermediate	786	71.90%	11.60%	10.31%	6.23%	NA
Temperate Japonica	767	1.20%	97.90%	0.26%	0.65%	NA
Tropical Japonica	504	1.20%	94.00%	0.79%	3.97%	NA
Japonica Intermediate	241	7.90%	70.10%	2.07%	19.92%	NA
VI/Aromatic	96	12.50%	85.40%	0.00%	2.08%	NA
Intermediate	90	27.80%	64.40%	4.44%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219113826	A -> DEL	N	N	silent_mutation	Average:44.199; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg1219113826	A -> G	LOC_Os12g31748.2	intron_variant ; MODIFIER	silent_mutation	Average:44.199; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg1219113826	A -> G	LOC_Os12g31748.1	intron_variant ; MODIFIER	silent_mutation	Average:44.199; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219113826	NA	4.95E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826	NA	4.09E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826	NA	4.00E-09	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826	NA	1.36E-20	mr1254	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826	NA	4.49E-17	mr1361	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826	NA	4.19E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826	NA	1.32E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826	NA	6.84E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826	NA	6.84E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826	NA	3.82E-06	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826	NA	3.48E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826	6.51E-07	NA	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826	NA	6.56E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219113826	NA	3.53E-09	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251