\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219062474:

Variant ID: vg1219062474 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19062474
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCACGAGCATCCTTTCTGTTCTTATGTGCTCGAGACTGATTGTTTGATCCCGGACTTTGTCTTTCACAATATAGTACTTTATGTCAATGTGTTTGGCA[A/G]
CACCACTTGACTGATTGTTGTGAGAGTACATTACTGCGGGTTTGCTATCGCAGTATAACTTTAGTGGTTTCTCAATACTGTCAACCACCTTTAAACCTGG

Reverse complement sequence

CCAGGTTTAAAGGTGGTTGACAGTATTGAGAAACCACTAAAGTTATACTGCGATAGCAAACCCGCAGTAATGTACTCTCACAACAATCAGTCAAGTGGTG[T/C]
TGCCAAACACATTGACATAAAGTACTATATTGTGAAAGACAAAGTCCGGGATCAAACAATCAGTCTCGAGCACATAAGAACAGAAAGGATGCTCGTGGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.90% 20.60% 1.48% 0.00% NA
All Indica  2759 86.80% 13.20% 0.04% 0.00% NA
All Japonica  1512 57.70% 37.80% 4.50% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 89.20% 10.80% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 81.70% 18.20% 0.11% 0.00% NA
Indica Intermediate  786 84.40% 15.60% 0.00% 0.00% NA
Temperate Japonica  767 36.00% 63.80% 0.26% 0.00% NA
Tropical Japonica  504 92.50% 4.00% 3.57% 0.00% NA
Japonica Intermediate  241 53.90% 26.10% 19.92% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 67.80% 31.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219062474 A -> G LOC_Os12g31640.2 downstream_gene_variant ; 1498.0bp to feature; MODIFIER silent_mutation Average:38.965; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg1219062474 A -> G LOC_Os12g31650.1 downstream_gene_variant ; 1459.0bp to feature; MODIFIER silent_mutation Average:38.965; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg1219062474 A -> G LOC_Os12g31640-LOC_Os12g31650 intergenic_region ; MODIFIER silent_mutation Average:38.965; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219062474 NA 2.06E-06 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219062474 NA 4.03E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219062474 6.63E-07 NA mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219062474 NA 1.43E-14 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219062474 NA 5.57E-06 mr1509 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219062474 1.25E-06 NA mr1563 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219062474 NA 2.73E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219062474 NA 8.36E-07 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219062474 NA 4.89E-06 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219062474 NA 3.06E-06 mr1981 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219062474 3.57E-06 NA mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219062474 NA 2.53E-06 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219062474 7.45E-09 NA mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219062474 NA 7.61E-17 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219062474 NA 3.30E-06 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219062474 NA 2.10E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251