\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218957771:

Variant ID: vg1218957771 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18957771
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTCCTTTTTTAAAATTGTTATTCTTTTCTTTCCTATTGTAAAGTCCAAGAAATACACGGAATAACCAATTTTTTGGAAAATTTATATCCAAATAGGTT[C/A]
TATGAATATCACTATTTAGAGTAAATTTTAGAAAACTGCAACTTTAGTGATAAGACTATCAGTTTGCTGCAACATTAACGACATGTTTCTGTTTACTACA

Reverse complement sequence

TGTAGTAAACAGAAACATGTCGTTAATGTTGCAGCAAACTGATAGTCTTATCACTAAAGTTGCAGTTTTCTAAAATTTACTCTAAATAGTGATATTCATA[G/T]
AACCTATTTGGATATAAATTTTCCAAAAAATTGGTTATTCCGTGTATTTCTTGGACTTTACAATAGGAAAGAAAAGAATAACAATTTTAAAAAAGGAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.40% 33.90% 15.55% 7.15% NA
All Indica  2759 32.40% 57.20% 8.12% 2.32% NA
All Japonica  1512 52.30% 0.60% 30.16% 16.93% NA
Aus  269 99.30% 0.40% 0.00% 0.37% NA
Indica I  595 25.00% 65.70% 6.39% 2.86% NA
Indica II  465 22.80% 58.50% 16.99% 1.72% NA
Indica III  913 37.60% 56.30% 3.83% 2.30% NA
Indica Intermediate  786 37.70% 50.90% 9.16% 2.29% NA
Temperate Japonica  767 69.50% 0.70% 20.47% 9.39% NA
Tropical Japonica  504 24.20% 0.40% 47.82% 27.58% NA
Japonica Intermediate  241 56.40% 0.80% 24.07% 18.67% NA
VI/Aromatic  96 50.00% 0.00% 35.42% 14.58% NA
Intermediate  90 54.40% 18.90% 23.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218957771 C -> DEL N N silent_mutation Average:22.015; most accessible tissue: Callus, score: 49.43 N N N N
vg1218957771 C -> A LOC_Os12g31510.1 downstream_gene_variant ; 1999.0bp to feature; MODIFIER silent_mutation Average:22.015; most accessible tissue: Callus, score: 49.43 N N N N
vg1218957771 C -> A LOC_Os12g31520.1 downstream_gene_variant ; 1616.0bp to feature; MODIFIER silent_mutation Average:22.015; most accessible tissue: Callus, score: 49.43 N N N N
vg1218957771 C -> A LOC_Os12g31510-LOC_Os12g31520 intergenic_region ; MODIFIER silent_mutation Average:22.015; most accessible tissue: Callus, score: 49.43 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218957771 NA 1.43E-06 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 3.63E-15 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 1.72E-08 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 6.39E-08 2.29E-60 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 9.56E-07 1.25E-19 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 2.80E-06 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 3.22E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 7.58E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 2.39E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 9.96E-12 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 7.93E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 9.15E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 1.47E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 1.84E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 1.07E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 5.08E-09 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 3.58E-24 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 3.68E-10 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 2.30E-09 5.72E-66 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 6.36E-10 9.84E-25 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 4.62E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 6.96E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 3.74E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 2.39E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 1.60E-10 mr1885_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 3.00E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771 NA 3.33E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251