Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218957771:

Variant ID: vg1218957771 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18957771
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTCCTTTTTTAAAATTGTTATTCTTTTCTTTCCTATTGTAAAGTCCAAGAAATACACGGAATAACCAATTTTTTGGAAAATTTATATCCAAATAGGTT[C/A]
TATGAATATCACTATTTAGAGTAAATTTTAGAAAACTGCAACTTTAGTGATAAGACTATCAGTTTGCTGCAACATTAACGACATGTTTCTGTTTACTACA

Reverse complement sequence

TGTAGTAAACAGAAACATGTCGTTAATGTTGCAGCAAACTGATAGTCTTATCACTAAAGTTGCAGTTTTCTAAAATTTACTCTAAATAGTGATATTCATA[G/T]
AACCTATTTGGATATAAATTTTCCAAAAAATTGGTTATTCCGTGTATTTCTTGGACTTTACAATAGGAAAGAAAAGAATAACAATTTTAAAAAAGGAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.40%	33.90%	15.55%	7.15%	NA
All Indica	2759	32.40%	57.20%	8.12%	2.32%	NA
All Japonica	1512	52.30%	0.60%	30.16%	16.93%	NA
Aus	269	99.30%	0.40%	0.00%	0.37%	NA
Indica I	595	25.00%	65.70%	6.39%	2.86%	NA
Indica II	465	22.80%	58.50%	16.99%	1.72%	NA
Indica III	913	37.60%	56.30%	3.83%	2.30%	NA
Indica Intermediate	786	37.70%	50.90%	9.16%	2.29%	NA
Temperate Japonica	767	69.50%	0.70%	20.47%	9.39%	NA
Tropical Japonica	504	24.20%	0.40%	47.82%	27.58%	NA
Japonica Intermediate	241	56.40%	0.80%	24.07%	18.67%	NA
VI/Aromatic	96	50.00%	0.00%	35.42%	14.58%	NA
Intermediate	90	54.40%	18.90%	23.33%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218957771	C -> DEL	N	N	silent_mutation	Average:22.015; most accessible tissue: Callus, score: 49.43	N	N	N	N
vg1218957771	C -> A	LOC_Os12g31510.1	downstream_gene_variant ; 1999.0bp to feature; MODIFIER	silent_mutation	Average:22.015; most accessible tissue: Callus, score: 49.43	N	N	N	N
vg1218957771	C -> A	LOC_Os12g31520.1	downstream_gene_variant ; 1616.0bp to feature; MODIFIER	silent_mutation	Average:22.015; most accessible tissue: Callus, score: 49.43	N	N	N	N
vg1218957771	C -> A	LOC_Os12g31510-LOC_Os12g31520	intergenic_region ; MODIFIER	silent_mutation	Average:22.015; most accessible tissue: Callus, score: 49.43	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218957771	NA	1.43E-06	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	3.63E-15	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	1.72E-08	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	6.39E-08	2.29E-60	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	9.56E-07	1.25E-19	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	2.80E-06	mr1686	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	3.22E-09	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	7.58E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	2.39E-08	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	9.96E-12	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	7.93E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	9.15E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	1.47E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	1.84E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	1.07E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	5.08E-09	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	3.58E-24	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	3.68E-10	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	2.30E-09	5.72E-66	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	6.36E-10	9.84E-25	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	4.62E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	6.96E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	3.74E-11	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	2.39E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	1.60E-10	mr1885_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	3.00E-21	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957771	NA	3.33E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251