\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218908610:

Variant ID: vg1218908610 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18908610
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, C: 0.15, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


ATATTGGTATCTATAGCTCTATCATGCATTGCCTCGTTTTTCTCTATAGACTATCTCTAAGTTATAGATAGCTTTGCTCTCTCTCTTTATTTAATACCTT[T/C]
AAAGTAGAAAAATATACTGACATGAATCTTTTGTAGAGAGTTTATAGATAACCATTTGTAGGTGGACTGAGTGACAGCAGCCACAAGCTCATAGAAGTCA

Reverse complement sequence

TGACTTCTATGAGCTTGTGGCTGCTGTCACTCAGTCCACCTACAAATGGTTATCTATAAACTCTCTACAAAAGATTCATGTCAGTATATTTTTCTACTTT[A/G]
AAGGTATTAAATAAAGAGAGAGAGCAAAGCTATCTATAACTTAGAGATAGTCTATAGAGAAAAACGAGGCAATGCATGATAGAGCTATAGATACCAATAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.40% 49.10% 0.21% 1.33% NA
All Indica  2759 82.00% 17.10% 0.18% 0.69% NA
All Japonica  1512 1.50% 98.40% 0.13% 0.00% NA
Aus  269 5.60% 86.20% 0.00% 8.18% NA
Indica I  595 87.40% 12.30% 0.34% 0.00% NA
Indica II  465 95.30% 4.30% 0.00% 0.43% NA
Indica III  913 78.20% 20.30% 0.00% 1.53% NA
Indica Intermediate  786 74.60% 24.70% 0.38% 0.38% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 94.60% 0.83% 0.00% NA
VI/Aromatic  96 10.40% 74.00% 0.00% 15.62% NA
Intermediate  90 26.70% 62.20% 3.33% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218908610 T -> C LOC_Os12g31440.1 upstream_gene_variant ; 221.0bp to feature; MODIFIER silent_mutation Average:98.212; most accessible tissue: Zhenshan97 panicle, score: 99.146 N N N N
vg1218908610 T -> C LOC_Os12g31430.1 downstream_gene_variant ; 3945.0bp to feature; MODIFIER silent_mutation Average:98.212; most accessible tissue: Zhenshan97 panicle, score: 99.146 N N N N
vg1218908610 T -> C LOC_Os12g31450.1 downstream_gene_variant ; 4644.0bp to feature; MODIFIER silent_mutation Average:98.212; most accessible tissue: Zhenshan97 panicle, score: 99.146 N N N N
vg1218908610 T -> C LOC_Os12g31430-LOC_Os12g31440 intergenic_region ; MODIFIER silent_mutation Average:98.212; most accessible tissue: Zhenshan97 panicle, score: 99.146 N N N N
vg1218908610 T -> DEL N N silent_mutation Average:98.212; most accessible tissue: Zhenshan97 panicle, score: 99.146 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1218908610 T C -0.02 -0.01 -0.01 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218908610 NA 7.43E-29 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 NA 8.80E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 NA 4.13E-37 mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 NA 1.94E-29 mr1237 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 NA 1.91E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 NA 1.37E-13 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 NA 5.67E-06 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 3.41E-14 1.57E-76 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 7.06E-11 1.57E-23 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 NA 6.06E-06 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 NA 1.88E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 NA 8.60E-35 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 NA 1.90E-24 mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 NA 3.85E-09 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 NA 3.15E-17 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 NA 1.11E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 NA 4.28E-23 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 NA 3.35E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 2.23E-06 1.23E-26 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 NA 9.89E-09 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 6.64E-18 4.88E-91 mr1458_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 2.66E-15 5.57E-33 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 NA 2.34E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218908610 NA 1.53E-09 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251