| Variant ID: vg1218884427 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18884427 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.03, others allele: 0.00, population size: 222. )
ACGGGAGAAGAGAGAAAGGGGTGTCGGGTCCCAAAACTAACAACTTGGATCCGACTAGAATTAATGTATTAATCCCTGGATCAGTAGATATTGATACATA[C/T]
AATATAACTGGTTCTTCATTGCATACGTTAAAGTTTTACAATACTAAGGGTTTAACAATAATAGGTACTCACCTAACTATTTAATACACAGCGGAAGTTT
AAACTTCCGCTGTGTATTAAATAGTTAGGTGAGTACCTATTATTGTTAAACCCTTAGTATTGTAAAACTTTAACGTATGCAATGAAGAACCAGTTATATT[G/A]
TATGTATCAATATCTACTGATCCAGGGATTAATACATTAATTCTAGTCGGATCCAAGTTGTTAGTTTTGGGACCCGACACCCCTTTCTCTCTTCTCCCGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 10.50% | 1.52% | 0.00% | NA |
| All Indica | 2759 | 88.70% | 10.10% | 1.16% | 0.00% | NA |
| All Japonica | 1512 | 99.00% | 0.70% | 0.26% | 0.00% | NA |
| Aus | 269 | 23.40% | 69.50% | 7.06% | 0.00% | NA |
| Indica I | 595 | 93.40% | 5.50% | 1.01% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.50% | 0.43% | 0.00% | NA |
| Indica III | 913 | 84.90% | 13.60% | 1.53% | 0.00% | NA |
| Indica Intermediate | 786 | 84.00% | 14.80% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 99.20% | 0.40% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 10.40% | 11.46% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 6.70% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218884427 | C -> T | LOC_Os12g31380.1 | upstream_gene_variant ; 2013.0bp to feature; MODIFIER | silent_mutation | Average:53.326; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 | N | N | N | N |
| vg1218884427 | C -> T | LOC_Os12g31390.1 | downstream_gene_variant ; 61.0bp to feature; MODIFIER | silent_mutation | Average:53.326; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 | N | N | N | N |
| vg1218884427 | C -> T | LOC_Os12g31390-LOC_Os12g31400 | intergenic_region ; MODIFIER | silent_mutation | Average:53.326; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218884427 | 2.86E-06 | NA | mr1245 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218884427 | 8.51E-06 | NA | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218884427 | NA | 1.90E-07 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218884427 | NA | 5.99E-06 | mr1686 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218884427 | 1.82E-06 | NA | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218884427 | NA | 4.22E-10 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |