Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1218873031:

Variant ID: vg1218873031 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18873031
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

TTTAGAGTAAAGTGCATTACCGGTCCTTAATCTTTTAAGTTTGTGTCATATAGGTCCCTAAACTCTCAAAATGCATATCCAGGTCCTACAACTTGTCAAA[G/A]
TGTATCATTTAGATCCCAAATCGATACATCCCCTCTAGGATCCAATGTGGCGCTGATGTGGCATGTCACATGGACGTGACGTGTCCTTTTCTTTTTTTTT

Reverse complement sequence

AAAAAAAAAGAAAAGGACACGTCACGTCCATGTGACATGCCACATCAGCGCCACATTGGATCCTAGAGGGGATGTATCGATTTGGGATCTAAATGATACA[C/T]
TTTGACAAGTTGTAGGACCTGGATATGCATTTTGAGAGTTTAGGGACCTATATGACACAAACTTAAAAGATTAAGGACCGGTAATGCACTTTACTCTAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.40%	41.00%	0.32%	1.29%	NA
All Indica	2759	34.10%	64.90%	0.36%	0.69%	NA
All Japonica	1512	94.20%	5.60%	0.20%	0.00%	NA
Aus	269	76.60%	15.60%	0.00%	7.81%	NA
Indica I	595	24.40%	75.00%	0.67%	0.00%	NA
Indica II	465	35.10%	64.10%	0.43%	0.43%	NA
Indica III	913	35.20%	63.20%	0.33%	1.31%	NA
Indica Intermediate	786	39.60%	59.70%	0.13%	0.64%	NA
Temperate Japonica	767	98.70%	1.20%	0.13%	0.00%	NA
Tropical Japonica	504	95.20%	4.60%	0.20%	0.00%	NA
Japonica Intermediate	241	78.00%	21.60%	0.41%	0.00%	NA
VI/Aromatic	96	81.20%	3.10%	0.00%	15.62%	NA
Intermediate	90	70.00%	21.10%	2.22%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218873031	G -> DEL	N	N	silent_mutation	Average:34.153; most accessible tissue: Callus, score: 51.903	N	N	N	N
vg1218873031	G -> A	LOC_Os12g31370.1	upstream_gene_variant ; 3084.0bp to feature; MODIFIER	silent_mutation	Average:34.153; most accessible tissue: Callus, score: 51.903	N	N	N	N
vg1218873031	G -> A	LOC_Os12g31350-LOC_Os12g31370	intergenic_region ; MODIFIER	silent_mutation	Average:34.153; most accessible tissue: Callus, score: 51.903	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218873031	2.20E-06	2.20E-06	mr1025	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031	1.36E-07	NA	mr1217	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031	8.61E-06	3.35E-07	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031	NA	5.56E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031	4.12E-07	8.46E-10	mr1275	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031	7.56E-06	7.56E-06	mr1275	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031	NA	1.20E-06	mr1339	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031	NA	1.92E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031	NA	1.25E-06	mr1358	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031	3.86E-06	NA	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031	NA	9.63E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031	NA	3.07E-06	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031	NA	7.27E-07	mr1485	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031	1.36E-06	1.36E-06	mr1688	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031	NA	9.19E-07	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031	NA	4.24E-06	mr1787	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031	3.51E-07	NA	mr1845	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031	NA	6.25E-06	mr1981	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251