\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218873031:

Variant ID: vg1218873031 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18873031
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAGAGTAAAGTGCATTACCGGTCCTTAATCTTTTAAGTTTGTGTCATATAGGTCCCTAAACTCTCAAAATGCATATCCAGGTCCTACAACTTGTCAAA[G/A]
TGTATCATTTAGATCCCAAATCGATACATCCCCTCTAGGATCCAATGTGGCGCTGATGTGGCATGTCACATGGACGTGACGTGTCCTTTTCTTTTTTTTT

Reverse complement sequence

AAAAAAAAAGAAAAGGACACGTCACGTCCATGTGACATGCCACATCAGCGCCACATTGGATCCTAGAGGGGATGTATCGATTTGGGATCTAAATGATACA[C/T]
TTTGACAAGTTGTAGGACCTGGATATGCATTTTGAGAGTTTAGGGACCTATATGACACAAACTTAAAAGATTAAGGACCGGTAATGCACTTTACTCTAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 41.00% 0.32% 1.29% NA
All Indica  2759 34.10% 64.90% 0.36% 0.69% NA
All Japonica  1512 94.20% 5.60% 0.20% 0.00% NA
Aus  269 76.60% 15.60% 0.00% 7.81% NA
Indica I  595 24.40% 75.00% 0.67% 0.00% NA
Indica II  465 35.10% 64.10% 0.43% 0.43% NA
Indica III  913 35.20% 63.20% 0.33% 1.31% NA
Indica Intermediate  786 39.60% 59.70% 0.13% 0.64% NA
Temperate Japonica  767 98.70% 1.20% 0.13% 0.00% NA
Tropical Japonica  504 95.20% 4.60% 0.20% 0.00% NA
Japonica Intermediate  241 78.00% 21.60% 0.41% 0.00% NA
VI/Aromatic  96 81.20% 3.10% 0.00% 15.62% NA
Intermediate  90 70.00% 21.10% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218873031 G -> DEL N N silent_mutation Average:34.153; most accessible tissue: Callus, score: 51.903 N N N N
vg1218873031 G -> A LOC_Os12g31370.1 upstream_gene_variant ; 3084.0bp to feature; MODIFIER silent_mutation Average:34.153; most accessible tissue: Callus, score: 51.903 N N N N
vg1218873031 G -> A LOC_Os12g31350-LOC_Os12g31370 intergenic_region ; MODIFIER silent_mutation Average:34.153; most accessible tissue: Callus, score: 51.903 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218873031 2.20E-06 2.20E-06 mr1025 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031 1.36E-07 NA mr1217 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031 8.61E-06 3.35E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031 NA 5.56E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031 4.12E-07 8.46E-10 mr1275 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031 7.56E-06 7.56E-06 mr1275 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031 NA 1.20E-06 mr1339 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031 NA 1.92E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031 NA 1.25E-06 mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031 3.86E-06 NA mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031 NA 9.63E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031 NA 3.07E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031 NA 7.27E-07 mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031 1.36E-06 1.36E-06 mr1688 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031 NA 9.19E-07 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031 NA 4.24E-06 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031 3.51E-07 NA mr1845 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218873031 NA 6.25E-06 mr1981 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251