\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218867722:

Variant ID: vg1218867722 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 18867722
Reference Allele: CAlternative Allele: T,CTTAAGT
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTTTATTATTGGGTTGCTAACACCTAACAACCAGCTAATAATCCAGAGAAACAAACAACTAACAACTTATATAGTAATCTGTCTCAATAATCAATAAT[C/T,CTTAAGT]
TAGATTACAATAATCTTAAGCTAAAACAAACAGGGCTTTAATTGAAACACGAAGCGGATTAGGATCACGTATCAAATGGATATGAAAAACATCTTTAATT

Reverse complement sequence

AATTAAAGATGTTTTTCATATCCATTTGATACGTGATCCTAATCCGCTTCGTGTTTCAATTAAAGCCCTGTTTGTTTTAGCTTAAGATTATTGTAATCTA[G/A,ACTTAAG]
ATTATTGATTATTGAGACAGATTACTATATAAGTTGTTAGTTGTTTGTTTCTCTGGATTATTAGCTGGTTGTTAGGTGTTAGCAACCCAATAATAAAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.30% 0.20% 3.43% 18.01% CTTAAGT: 0.02%
All Indica  2759 96.60% 0.10% 0.54% 2.68% CTTAAGT: 0.04%
All Japonica  1512 46.70% 0.00% 8.93% 44.38% NA
Aus  269 89.20% 2.60% 0.00% 8.18% NA
Indica I  595 97.30% 0.00% 1.01% 1.68% NA
Indica II  465 98.90% 0.00% 0.00% 1.08% NA
Indica III  913 96.20% 0.20% 0.11% 3.50% NA
Indica Intermediate  786 95.30% 0.10% 1.02% 3.44% CTTAAGT: 0.13%
Temperate Japonica  767 65.70% 0.00% 8.21% 26.08% NA
Tropical Japonica  504 13.30% 0.00% 8.93% 77.78% NA
Japonica Intermediate  241 56.00% 0.00% 11.20% 32.78% NA
VI/Aromatic  96 27.10% 0.00% 7.29% 65.62% NA
Intermediate  90 71.10% 0.00% 5.56% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218867722 C -> DEL N N silent_mutation Average:31.868; most accessible tissue: Callus, score: 82.635 N N N N
vg1218867722 C -> CTTAAGT LOC_Os12g31350-LOC_Os12g31370 intergenic_region ; MODIFIER silent_mutation Average:31.868; most accessible tissue: Callus, score: 82.635 N N N N
vg1218867722 C -> T LOC_Os12g31350-LOC_Os12g31370 intergenic_region ; MODIFIER silent_mutation Average:31.868; most accessible tissue: Callus, score: 82.635 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218867722 NA 1.57E-06 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 NA 1.00E-14 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 NA 4.56E-06 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 2.95E-09 1.03E-59 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 9.46E-06 1.73E-14 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 NA 4.36E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 NA 1.10E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 NA 1.72E-12 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 NA 7.80E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 NA 9.44E-08 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 NA 5.09E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 NA 4.09E-07 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 NA 1.51E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 NA 4.79E-23 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 NA 2.66E-06 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 4.94E-08 1.08E-60 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 NA 2.20E-13 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 NA 1.43E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 NA 8.70E-07 mr1756_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 NA 2.26E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 NA 6.51E-10 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722 NA 5.94E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251