Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218867722:

Variant ID: vg1218867722 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 18867722
Reference Allele: C	Alternative Allele: T,CTTAAGT
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:

CTTTTTATTATTGGGTTGCTAACACCTAACAACCAGCTAATAATCCAGAGAAACAAACAACTAACAACTTATATAGTAATCTGTCTCAATAATCAATAAT[C/T,CTTAAGT]
TAGATTACAATAATCTTAAGCTAAAACAAACAGGGCTTTAATTGAAACACGAAGCGGATTAGGATCACGTATCAAATGGATATGAAAAACATCTTTAATT

Reverse complement sequence

AATTAAAGATGTTTTTCATATCCATTTGATACGTGATCCTAATCCGCTTCGTGTTTCAATTAAAGCCCTGTTTGTTTTAGCTTAAGATTATTGTAATCTA[G/A,ACTTAAG]
ATTATTGATTATTGAGACAGATTACTATATAAGTTGTTAGTTGTTTGTTTCTCTGGATTATTAGCTGGTTGTTAGGTGTTAGCAACCCAATAATAAAAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.30%	0.20%	3.43%	18.01%	CTTAAGT: 0.02%
All Indica	2759	96.60%	0.10%	0.54%	2.68%	CTTAAGT: 0.04%
All Japonica	1512	46.70%	0.00%	8.93%	44.38%	NA
Aus	269	89.20%	2.60%	0.00%	8.18%	NA
Indica I	595	97.30%	0.00%	1.01%	1.68%	NA
Indica II	465	98.90%	0.00%	0.00%	1.08%	NA
Indica III	913	96.20%	0.20%	0.11%	3.50%	NA
Indica Intermediate	786	95.30%	0.10%	1.02%	3.44%	CTTAAGT: 0.13%
Temperate Japonica	767	65.70%	0.00%	8.21%	26.08%	NA
Tropical Japonica	504	13.30%	0.00%	8.93%	77.78%	NA
Japonica Intermediate	241	56.00%	0.00%	11.20%	32.78%	NA
VI/Aromatic	96	27.10%	0.00%	7.29%	65.62%	NA
Intermediate	90	71.10%	0.00%	5.56%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218867722	C -> DEL	N	N	silent_mutation	Average:31.868; most accessible tissue: Callus, score: 82.635	N	N	N	N
vg1218867722	C -> CTTAAGT	LOC_Os12g31350-LOC_Os12g31370	intergenic_region ; MODIFIER	silent_mutation	Average:31.868; most accessible tissue: Callus, score: 82.635	N	N	N	N
vg1218867722	C -> T	LOC_Os12g31350-LOC_Os12g31370	intergenic_region ; MODIFIER	silent_mutation	Average:31.868; most accessible tissue: Callus, score: 82.635	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218867722	NA	1.57E-06	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	NA	1.00E-14	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	NA	4.56E-06	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	2.95E-09	1.03E-59	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	9.46E-06	1.73E-14	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	NA	4.36E-09	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	NA	1.10E-08	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	NA	1.72E-12	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	NA	7.80E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	NA	9.44E-08	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	NA	5.09E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	NA	4.09E-07	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	NA	1.51E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	NA	4.79E-23	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	NA	2.66E-06	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	4.94E-08	1.08E-60	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	NA	2.20E-13	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	NA	1.43E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	NA	8.70E-07	mr1756_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	NA	2.26E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	NA	6.51E-10	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218867722	NA	5.94E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251