\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218849677:

Variant ID: vg1218849677 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18849677
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TAATTAATGACATGACATGAACACATGAGACATCTGTAGAGAACCAACAGTGCACACAGAATTGCATGAACAAACTAACGAGACGGGTGTACTGAGCGCC[A/G]
CTACTCGCATGAGCAACTTTTGTCGTGTGAACTATGAACTATTTATAGGCTGAGCATCAGGATAGTATTGCTTAGTATACCACATGATGGAGAGCTAGAG

Reverse complement sequence

CTCTAGCTCTCCATCATGTGGTATACTAAGCAATACTATCCTGATGCTCAGCCTATAAATAGTTCATAGTTCACACGACAAAAGTTGCTCATGCGAGTAG[T/C]
GGCGCTCAGTACACCCGTCTCGTTAGTTTGTTCATGCAATTCTGTGTGCACTGTTGGTTCTCTACAGATGTCTCATGTGTTCATGTCATGTCATTAATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.00% 37.10% 0.44% 0.55% NA
All Indica  2759 69.60% 29.30% 0.47% 0.62% NA
All Japonica  1512 56.00% 43.90% 0.07% 0.00% NA
Aus  269 16.40% 81.80% 1.49% 0.37% NA
Indica I  595 75.50% 24.40% 0.17% 0.00% NA
Indica II  465 82.40% 17.00% 0.65% 0.00% NA
Indica III  913 65.50% 32.50% 0.66% 1.31% NA
Indica Intermediate  786 62.50% 36.50% 0.38% 0.64% NA
Temperate Japonica  767 35.60% 64.40% 0.00% 0.00% NA
Tropical Japonica  504 90.90% 8.90% 0.20% 0.00% NA
Japonica Intermediate  241 48.10% 51.90% 0.00% 0.00% NA
VI/Aromatic  96 66.70% 22.90% 2.08% 8.33% NA
Intermediate  90 57.80% 41.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218849677 A -> DEL N N silent_mutation Average:50.287; most accessible tissue: Callus, score: 89.583 N N N N
vg1218849677 A -> G LOC_Os12g31330.1 upstream_gene_variant ; 2056.0bp to feature; MODIFIER silent_mutation Average:50.287; most accessible tissue: Callus, score: 89.583 N N N N
vg1218849677 A -> G LOC_Os12g31320.1 downstream_gene_variant ; 4009.0bp to feature; MODIFIER silent_mutation Average:50.287; most accessible tissue: Callus, score: 89.583 N N N N
vg1218849677 A -> G LOC_Os12g31340.1 downstream_gene_variant ; 1388.0bp to feature; MODIFIER silent_mutation Average:50.287; most accessible tissue: Callus, score: 89.583 N N N N
vg1218849677 A -> G LOC_Os12g31330-LOC_Os12g31340 intergenic_region ; MODIFIER silent_mutation Average:50.287; most accessible tissue: Callus, score: 89.583 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218849677 NA 4.09E-06 mr1171 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218849677 NA 1.79E-08 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218849677 5.18E-06 NA mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218849677 NA 7.16E-11 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218849677 NA 6.79E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218849677 NA 2.53E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218849677 NA 7.40E-06 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218849677 4.96E-09 NA mr1458_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218849677 NA 1.77E-09 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218849677 NA 4.90E-07 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251