\
| Variant ID: vg1218849677 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18849677 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 218. )
TAATTAATGACATGACATGAACACATGAGACATCTGTAGAGAACCAACAGTGCACACAGAATTGCATGAACAAACTAACGAGACGGGTGTACTGAGCGCC[A/G]
CTACTCGCATGAGCAACTTTTGTCGTGTGAACTATGAACTATTTATAGGCTGAGCATCAGGATAGTATTGCTTAGTATACCACATGATGGAGAGCTAGAG
CTCTAGCTCTCCATCATGTGGTATACTAAGCAATACTATCCTGATGCTCAGCCTATAAATAGTTCATAGTTCACACGACAAAAGTTGCTCATGCGAGTAG[T/C]
GGCGCTCAGTACACCCGTCTCGTTAGTTTGTTCATGCAATTCTGTGTGCACTGTTGGTTCTCTACAGATGTCTCATGTGTTCATGTCATGTCATTAATTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.00% | 37.10% | 0.44% | 0.55% | NA |
| All Indica | 2759 | 69.60% | 29.30% | 0.47% | 0.62% | NA |
| All Japonica | 1512 | 56.00% | 43.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 16.40% | 81.80% | 1.49% | 0.37% | NA |
| Indica I | 595 | 75.50% | 24.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 82.40% | 17.00% | 0.65% | 0.00% | NA |
| Indica III | 913 | 65.50% | 32.50% | 0.66% | 1.31% | NA |
| Indica Intermediate | 786 | 62.50% | 36.50% | 0.38% | 0.64% | NA |
| Temperate Japonica | 767 | 35.60% | 64.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.90% | 8.90% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 48.10% | 51.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 66.70% | 22.90% | 2.08% | 8.33% | NA |
| Intermediate | 90 | 57.80% | 41.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218849677 | A -> DEL | N | N | silent_mutation | Average:50.287; most accessible tissue: Callus, score: 89.583 | N | N | N | N |
| vg1218849677 | A -> G | LOC_Os12g31330.1 | upstream_gene_variant ; 2056.0bp to feature; MODIFIER | silent_mutation | Average:50.287; most accessible tissue: Callus, score: 89.583 | N | N | N | N |
| vg1218849677 | A -> G | LOC_Os12g31320.1 | downstream_gene_variant ; 4009.0bp to feature; MODIFIER | silent_mutation | Average:50.287; most accessible tissue: Callus, score: 89.583 | N | N | N | N |
| vg1218849677 | A -> G | LOC_Os12g31340.1 | downstream_gene_variant ; 1388.0bp to feature; MODIFIER | silent_mutation | Average:50.287; most accessible tissue: Callus, score: 89.583 | N | N | N | N |
| vg1218849677 | A -> G | LOC_Os12g31330-LOC_Os12g31340 | intergenic_region ; MODIFIER | silent_mutation | Average:50.287; most accessible tissue: Callus, score: 89.583 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218849677 | NA | 4.09E-06 | mr1171 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218849677 | NA | 1.79E-08 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218849677 | 5.18E-06 | NA | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218849677 | NA | 7.16E-11 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218849677 | NA | 6.79E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218849677 | NA | 2.53E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218849677 | NA | 7.40E-06 | mr1912 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218849677 | 4.96E-09 | NA | mr1458_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218849677 | NA | 1.77E-09 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218849677 | NA | 4.90E-07 | mr1458_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |