\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218763524:

Variant ID: vg1218763524 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18763524
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.55, A: 0.43, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


GCTCCTCCATAGGCTCATCCAGTCCAACCAGCCTACGGCTAACACCGTACAGAAGCTGAGGGTCGACGGTGACGTTGCTGGGGCGGAGGTCGTCGGTGAC[G/A]
TCGTCCACGACAGGGGCGCTCTGGAGCATGTACCTGGTCCGCCTTTGGCTGGCATCCTCGACGCGGTCCTTGAGCTCCTTTATCAGCTCAGCGAGCTTCC

Reverse complement sequence

GGAAGCTCGCTGAGCTGATAAAGGAGCTCAAGGACCGCGTCGAGGATGCCAGCCAAAGGCGGACCAGGTACATGCTCCAGAGCGCCCCTGTCGTGGACGA[C/T]
GTCACCGACGACCTCCGCCCCAGCAACGTCACCGTCGACCCTCAGCTTCTGTACGGTGTTAGCCGTAGGCTGGTTGGACTGGATGAGCCTATGGAGGAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 43.40% 3.45% 2.43% NA
All Indica  2759 24.20% 70.60% 4.20% 0.94% NA
All Japonica  1512 92.20% 1.60% 0.93% 5.29% NA
Aus  269 68.40% 18.20% 10.41% 2.97% NA
Indica I  595 20.70% 74.80% 4.37% 0.17% NA
Indica II  465 12.70% 84.50% 2.58% 0.22% NA
Indica III  913 25.80% 68.20% 3.50% 2.41% NA
Indica Intermediate  786 31.80% 62.10% 5.85% 0.25% NA
Temperate Japonica  767 88.50% 1.60% 0.52% 9.39% NA
Tropical Japonica  504 99.00% 0.40% 0.20% 0.40% NA
Japonica Intermediate  241 89.60% 4.10% 3.73% 2.49% NA
VI/Aromatic  96 87.50% 10.40% 2.08% 0.00% NA
Intermediate  90 75.60% 20.00% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218763524 G -> DEL LOC_Os12g31160.1 N frameshift_variant Average:79.902; most accessible tissue: Zhenshan97 young leaf, score: 88.995 N N N N
vg1218763524 G -> A LOC_Os12g31160.1 synonymous_variant ; p.Asp136Asp; LOW synonymous_codon Average:79.902; most accessible tissue: Zhenshan97 young leaf, score: 88.995 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1218763524 G A -0.04 -0.03 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218763524 9.56E-06 NA mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 1.07E-07 8.80E-08 mr1071 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 3.53E-08 1.13E-07 mr1080 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 4.15E-06 NA mr1100 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 NA 3.19E-07 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 NA 1.98E-08 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 3.52E-06 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 2.55E-11 9.94E-11 mr1140 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 NA 2.69E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 1.20E-09 2.07E-09 mr1203 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 8.45E-07 NA mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 4.49E-06 NA mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 8.87E-10 1.83E-09 mr1395 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 NA 2.45E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 1.29E-08 NA mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 1.31E-08 6.29E-11 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 3.75E-07 NA mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 1.51E-09 1.64E-09 mr1618 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 NA 1.46E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 NA 1.05E-10 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 NA 3.69E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 NA 3.13E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 1.52E-07 1.52E-07 mr1822 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 NA 4.72E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218763524 NA 3.45E-07 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251