\
| Variant ID: vg1218705117 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18705117 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.19, others allele: 0.00, population size: 94. )
ATCAATCTGCGGCACCGCCACGCATGTACGTACGCAAAATCGTATATATAAGCAAACGCATGCACGTACGTAGCTAATCATTGTACGTGCATATACGGAC[A/G]
TACGCACATATAGCATTTGCAAACCCACACGCAAGTAGCATAGTAATCTTTATACACAGATGCATAAGCACATACGTCGGTCTCGCATGGTTCAGCTGCG
CGCAGCTGAACCATGCGAGACCGACGTATGTGCTTATGCATCTGTGTATAAAGATTACTATGCTACTTGCGTGTGGGTTTGCAAATGCTATATGTGCGTA[T/C]
GTCCGTATATGCACGTACAATGATTAGCTACGTACGTGCATGCGTTTGCTTATATATACGATTTTGCGTACGTACATGCGTGGCGGTGCCGCAGATTGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.20% | 32.70% | 2.75% | 1.33% | NA |
| All Indica | 2759 | 69.80% | 23.60% | 4.31% | 2.28% | NA |
| All Japonica | 1512 | 59.40% | 40.00% | 0.60% | 0.00% | NA |
| Aus | 269 | 10.40% | 89.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 77.00% | 18.80% | 0.00% | 4.20% | NA |
| Indica II | 465 | 67.70% | 14.20% | 17.42% | 0.65% | NA |
| Indica III | 913 | 70.40% | 27.50% | 0.88% | 1.20% | NA |
| Indica Intermediate | 786 | 64.90% | 28.20% | 3.82% | 3.05% | NA |
| Temperate Japonica | 767 | 39.60% | 60.10% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 93.10% | 6.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 51.90% | 45.60% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 10.40% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 41.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218705117 | A -> DEL | N | N | silent_mutation | Average:76.012; most accessible tissue: Zhenshan97 young leaf, score: 89.875 | N | N | N | N |
| vg1218705117 | A -> G | LOC_Os12g31110-LOC_Os12g31120 | intergenic_region ; MODIFIER | silent_mutation | Average:76.012; most accessible tissue: Zhenshan97 young leaf, score: 89.875 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218705117 | NA | 4.52E-08 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218705117 | 2.71E-06 | 2.05E-09 | mr1171 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218705117 | NA | 6.29E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218705117 | NA | 3.93E-08 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218705117 | NA | 1.39E-09 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218705117 | NA | 2.69E-11 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218705117 | NA | 2.70E-07 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218705117 | NA | 1.22E-08 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218705117 | NA | 6.10E-06 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218705117 | NA | 9.82E-07 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218705117 | NA | 8.42E-06 | mr1742 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218705117 | NA | 3.57E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218705117 | NA | 6.68E-06 | mr1851 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218705117 | NA | 1.52E-07 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218705117 | NA | 4.61E-09 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218705117 | NA | 4.99E-06 | mr1458_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218705117 | NA | 2.59E-07 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |