Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218595780:

Variant ID: vg1218595780 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18595780
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:

TAACAAATTTAGGTACTACAAATACATTATAAGAGTTCAGGACCGCACAAGTTAGAGACCGCCCATGTATTTCATTCTTCAGATTTTTATGGATGATATG[G/A]
AAAAACGAGTCGACCTAAGAGAAAGACTTGGTGAGTGTACCTCAATGCGGATTGAGTTCCGCCGGTGGATGGCGATGGAAACCCCCAGCCTCCCGCCGAC

Reverse complement sequence

GTCGGCGGGAGGCTGGGGGTTTCCATCGCCATCCACCGGCGGAACTCAATCCGCATTGAGGTACACTCACCAAGTCTTTCTCTTAGGTCGACTCGTTTTT[C/T]
CATATCATCCATAAAAATCTGAAGAATGAAATACATGGGCGGTCTCTAACTTGTGCGGTCCTGAACTCTTATAATGTATTTGTAGTACCTAAATTTGTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.30%	16.20%	7.79%	8.76%	NA
All Indica	2759	44.90%	27.20%	13.12%	14.75%	NA
All Japonica	1512	99.40%	0.40%	0.07%	0.13%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	64.00%	16.10%	15.97%	3.87%	NA
Indica II	465	32.90%	26.00%	16.13%	24.95%	NA
Indica III	913	40.30%	35.50%	8.00%	16.21%	NA
Indica Intermediate	786	42.90%	26.70%	15.14%	15.27%	NA
Temperate Japonica	767	99.20%	0.50%	0.00%	0.26%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	7.80%	4.44%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218595780	G -> DEL	N	N	silent_mutation	Average:55.148; most accessible tissue: Callus, score: 73.832	N	N	N	N
vg1218595780	G -> A	LOC_Os12g30960.1	upstream_gene_variant ; 2430.0bp to feature; MODIFIER	silent_mutation	Average:55.148; most accessible tissue: Callus, score: 73.832	N	N	N	N
vg1218595780	G -> A	LOC_Os12g30960-LOC_Os12g30980	intergenic_region ; MODIFIER	silent_mutation	Average:55.148; most accessible tissue: Callus, score: 73.832	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218595780	NA	1.34E-06	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595780	NA	1.14E-06	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595780	2.57E-10	7.79E-21	mr1457	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595780	4.24E-08	8.04E-12	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595780	2.81E-14	2.79E-53	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595780	9.29E-11	1.03E-16	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595780	NA	9.76E-06	mr1686	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595780	NA	5.60E-07	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595780	2.95E-11	1.05E-29	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595780	7.19E-09	9.25E-14	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595780	7.77E-18	1.27E-59	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595780	2.21E-15	2.23E-21	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595780	NA	3.62E-07	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251