Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218592189:

Variant ID: vg1218592189 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18592189
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, T: 0.16, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

AAAATAAAAAAAAATCGGACGGAGGAAAGCTAGGATGCTGAGGAAAGGTGGGGTGGTAAACAAAGGGAAAACCGAACGGAATGAGCATTGTGCGGTGCTC[G/T]
AACTAGCACTCCACGTGCGCCACGCATATTAGCACCACCACTATTATTATCTATCAGTATTTATAAGCTGAGGAACAACCTAATATTCAAAATCAATCAA

Reverse complement sequence

TTGATTGATTTTGAATATTAGGTTGTTCCTCAGCTTATAAATACTGATAGATAATAATAGTGGTGGTGCTAATATGCGTGGCGCACGTGGAGTGCTAGTT[C/A]
GAGCACCGCACAATGCTCATTCCGTTCGGTTTTCCCTTTGTTTACCACCCCACCTTTCCTCAGCATCCTAGCTTTCCTCCGTCCGATTTTTTTTTATTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.70%	28.20%	0.02%	0.00%	NA
All Indica	2759	62.60%	37.30%	0.04%	0.00%	NA
All Japonica	1512	98.00%	2.00%	0.00%	0.00%	NA
Aus	269	9.70%	90.30%	0.00%	0.00%	NA
Indica I	595	43.70%	56.30%	0.00%	0.00%	NA
Indica II	465	72.90%	27.10%	0.00%	0.00%	NA
Indica III	913	64.50%	35.40%	0.11%	0.00%	NA
Indica Intermediate	786	68.70%	31.30%	0.00%	0.00%	NA
Temperate Japonica	767	99.00%	1.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	93.40%	6.60%	0.00%	0.00%	NA
VI/Aromatic	96	80.20%	19.80%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218592189	G -> T	LOC_Os12g30950.1	upstream_gene_variant ; 4235.0bp to feature; MODIFIER	silent_mutation	Average:39.577; most accessible tissue: Callus, score: 83.155	N	N	N	N
vg1218592189	G -> T	LOC_Os12g30960.1	downstream_gene_variant ; 284.0bp to feature; MODIFIER	silent_mutation	Average:39.577; most accessible tissue: Callus, score: 83.155	N	N	N	N
vg1218592189	G -> T	LOC_Os12g30950-LOC_Os12g30960	intergenic_region ; MODIFIER	silent_mutation	Average:39.577; most accessible tissue: Callus, score: 83.155	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218592189	NA	5.63E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218592189	6.04E-07	NA	mr1457	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218592189	7.43E-07	1.71E-09	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218592189	NA	2.11E-08	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218592189	NA	4.31E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218592189	2.67E-06	NA	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218592189	NA	3.79E-08	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218592189	7.19E-07	NA	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218592189	3.21E-06	1.23E-09	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218592189	NA	2.59E-07	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251