Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218592189:

Variant ID: vg1218592189 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18592189
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, T: 0.16, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATAAAAAAAAATCGGACGGAGGAAAGCTAGGATGCTGAGGAAAGGTGGGGTGGTAAACAAAGGGAAAACCGAACGGAATGAGCATTGTGCGGTGCTC[G/T]
AACTAGCACTCCACGTGCGCCACGCATATTAGCACCACCACTATTATTATCTATCAGTATTTATAAGCTGAGGAACAACCTAATATTCAAAATCAATCAA

Reverse complement sequence

TTGATTGATTTTGAATATTAGGTTGTTCCTCAGCTTATAAATACTGATAGATAATAATAGTGGTGGTGCTAATATGCGTGGCGCACGTGGAGTGCTAGTT[C/A]
GAGCACCGCACAATGCTCATTCCGTTCGGTTTTCCCTTTGTTTACCACCCCACCTTTCCTCAGCATCCTAGCTTTCCTCCGTCCGATTTTTTTTTATTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.70% 28.20% 0.02% 0.00% NA
All Indica  2759 62.60% 37.30% 0.04% 0.00% NA
All Japonica  1512 98.00% 2.00% 0.00% 0.00% NA
Aus  269 9.70% 90.30% 0.00% 0.00% NA
Indica I  595 43.70% 56.30% 0.00% 0.00% NA
Indica II  465 72.90% 27.10% 0.00% 0.00% NA
Indica III  913 64.50% 35.40% 0.11% 0.00% NA
Indica Intermediate  786 68.70% 31.30% 0.00% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.60% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218592189 G -> T LOC_Os12g30950.1 upstream_gene_variant ; 4235.0bp to feature; MODIFIER silent_mutation Average:39.577; most accessible tissue: Callus, score: 83.155 N N N N
vg1218592189 G -> T LOC_Os12g30960.1 downstream_gene_variant ; 284.0bp to feature; MODIFIER silent_mutation Average:39.577; most accessible tissue: Callus, score: 83.155 N N N N
vg1218592189 G -> T LOC_Os12g30950-LOC_Os12g30960 intergenic_region ; MODIFIER silent_mutation Average:39.577; most accessible tissue: Callus, score: 83.155 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218592189 NA 5.63E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218592189 6.04E-07 NA mr1457 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218592189 7.43E-07 1.71E-09 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218592189 NA 2.11E-08 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218592189 NA 4.31E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218592189 2.67E-06 NA mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218592189 NA 3.79E-08 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218592189 7.19E-07 NA mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218592189 3.21E-06 1.23E-09 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218592189 NA 2.59E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251