\
| Variant ID: vg1218592189 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18592189 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, T: 0.16, others allele: 0.00, population size: 109. )
AAAATAAAAAAAAATCGGACGGAGGAAAGCTAGGATGCTGAGGAAAGGTGGGGTGGTAAACAAAGGGAAAACCGAACGGAATGAGCATTGTGCGGTGCTC[G/T]
AACTAGCACTCCACGTGCGCCACGCATATTAGCACCACCACTATTATTATCTATCAGTATTTATAAGCTGAGGAACAACCTAATATTCAAAATCAATCAA
TTGATTGATTTTGAATATTAGGTTGTTCCTCAGCTTATAAATACTGATAGATAATAATAGTGGTGGTGCTAATATGCGTGGCGCACGTGGAGTGCTAGTT[C/A]
GAGCACCGCACAATGCTCATTCCGTTCGGTTTTCCCTTTGTTTACCACCCCACCTTTCCTCAGCATCCTAGCTTTCCTCCGTCCGATTTTTTTTTATTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.70% | 28.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 62.60% | 37.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 9.70% | 90.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 43.70% | 56.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 72.90% | 27.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 64.50% | 35.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 68.70% | 31.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218592189 | G -> T | LOC_Os12g30950.1 | upstream_gene_variant ; 4235.0bp to feature; MODIFIER | silent_mutation | Average:39.577; most accessible tissue: Callus, score: 83.155 | N | N | N | N |
| vg1218592189 | G -> T | LOC_Os12g30960.1 | downstream_gene_variant ; 284.0bp to feature; MODIFIER | silent_mutation | Average:39.577; most accessible tissue: Callus, score: 83.155 | N | N | N | N |
| vg1218592189 | G -> T | LOC_Os12g30950-LOC_Os12g30960 | intergenic_region ; MODIFIER | silent_mutation | Average:39.577; most accessible tissue: Callus, score: 83.155 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218592189 | NA | 5.63E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218592189 | 6.04E-07 | NA | mr1457 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218592189 | 7.43E-07 | 1.71E-09 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218592189 | NA | 2.11E-08 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218592189 | NA | 4.31E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218592189 | 2.67E-06 | NA | mr1457_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218592189 | NA | 3.79E-08 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218592189 | 7.19E-07 | NA | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218592189 | 3.21E-06 | 1.23E-09 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218592189 | NA | 2.59E-07 | mr1805_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |