\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218591659:

Variant ID: vg1218591659 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18591659
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTCCTTAACCGAATCCTCTAAGAATTTAACTGCTGGCGACTCGATAACTCCCATTGGCCGATTCCAGAACTCTAAAGCCAATATTGATTTTAGGTTG[A/T]
TGACGTCTTCAGGGCTTACCATATTTCGTTGTTAACACACTGGTAAAATAATTACTAGAGTTATAAGTTGATAGTTTTTTTTTATGGCCATCTAGGAACG

Reverse complement sequence

CGTTCCTAGATGGCCATAAAAAAAAACTATCAACTTATAACTCTAGTAATTATTTTACCAGTGTGTTAACAACGAAATATGGTAAGCCCTGAAGACGTCA[T/A]
CAACCTAAAATCAATATTGGCTTTAGAGTTCTGGAATCGGCCAATGGGAGTTATCGAGTCGCCAGCAGTTAAATTCTTAGAGGATTCGGTTAAGGAAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.30% 41.40% 0.15% 1.10% NA
All Indica  2759 58.90% 40.90% 0.14% 0.04% NA
All Japonica  1512 64.50% 35.40% 0.13% 0.00% NA
Aus  269 1.10% 81.00% 0.00% 17.84% NA
Indica I  595 39.70% 60.20% 0.17% 0.00% NA
Indica II  465 67.70% 32.30% 0.00% 0.00% NA
Indica III  913 63.00% 36.90% 0.11% 0.00% NA
Indica Intermediate  786 63.50% 36.10% 0.25% 0.13% NA
Temperate Japonica  767 40.90% 58.80% 0.26% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 73.00% 27.00% 0.00% 0.00% NA
VI/Aromatic  96 63.50% 33.30% 1.04% 2.08% NA
Intermediate  90 50.00% 48.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218591659 A -> DEL N N silent_mutation Average:25.887; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N
vg1218591659 A -> T LOC_Os12g30950.1 upstream_gene_variant ; 3705.0bp to feature; MODIFIER silent_mutation Average:25.887; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N
vg1218591659 A -> T LOC_Os12g30960.1 downstream_gene_variant ; 814.0bp to feature; MODIFIER silent_mutation Average:25.887; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N
vg1218591659 A -> T LOC_Os12g30950-LOC_Os12g30960 intergenic_region ; MODIFIER silent_mutation Average:25.887; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218591659 NA 1.95E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218591659 1.01E-08 5.09E-13 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218591659 1.21E-06 4.37E-09 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218591659 1.27E-06 NA mr1458 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218591659 NA 1.79E-08 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218591659 9.52E-06 9.51E-06 mr1462 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218591659 NA 1.77E-07 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218591659 4.21E-08 NA mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218591659 5.68E-06 2.50E-08 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218591659 3.58E-11 NA mr1458_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218591659 1.29E-06 2.17E-09 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218591659 NA 2.04E-06 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218591659 NA 5.03E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251