\
| Variant ID: vg1218591659 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18591659 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 103. )
AATTTCCTTAACCGAATCCTCTAAGAATTTAACTGCTGGCGACTCGATAACTCCCATTGGCCGATTCCAGAACTCTAAAGCCAATATTGATTTTAGGTTG[A/T]
TGACGTCTTCAGGGCTTACCATATTTCGTTGTTAACACACTGGTAAAATAATTACTAGAGTTATAAGTTGATAGTTTTTTTTTATGGCCATCTAGGAACG
CGTTCCTAGATGGCCATAAAAAAAAACTATCAACTTATAACTCTAGTAATTATTTTACCAGTGTGTTAACAACGAAATATGGTAAGCCCTGAAGACGTCA[T/A]
CAACCTAAAATCAATATTGGCTTTAGAGTTCTGGAATCGGCCAATGGGAGTTATCGAGTCGCCAGCAGTTAAATTCTTAGAGGATTCGGTTAAGGAAATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.30% | 41.40% | 0.15% | 1.10% | NA |
| All Indica | 2759 | 58.90% | 40.90% | 0.14% | 0.04% | NA |
| All Japonica | 1512 | 64.50% | 35.40% | 0.13% | 0.00% | NA |
| Aus | 269 | 1.10% | 81.00% | 0.00% | 17.84% | NA |
| Indica I | 595 | 39.70% | 60.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 67.70% | 32.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 63.00% | 36.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 63.50% | 36.10% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 40.90% | 58.80% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.00% | 27.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 63.50% | 33.30% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 50.00% | 48.90% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218591659 | A -> DEL | N | N | silent_mutation | Average:25.887; most accessible tissue: Minghui63 young leaf, score: 42.042 | N | N | N | N |
| vg1218591659 | A -> T | LOC_Os12g30950.1 | upstream_gene_variant ; 3705.0bp to feature; MODIFIER | silent_mutation | Average:25.887; most accessible tissue: Minghui63 young leaf, score: 42.042 | N | N | N | N |
| vg1218591659 | A -> T | LOC_Os12g30960.1 | downstream_gene_variant ; 814.0bp to feature; MODIFIER | silent_mutation | Average:25.887; most accessible tissue: Minghui63 young leaf, score: 42.042 | N | N | N | N |
| vg1218591659 | A -> T | LOC_Os12g30950-LOC_Os12g30960 | intergenic_region ; MODIFIER | silent_mutation | Average:25.887; most accessible tissue: Minghui63 young leaf, score: 42.042 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218591659 | NA | 1.95E-06 | mr1280 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218591659 | 1.01E-08 | 5.09E-13 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218591659 | 1.21E-06 | 4.37E-09 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218591659 | 1.27E-06 | NA | mr1458 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218591659 | NA | 1.79E-08 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218591659 | 9.52E-06 | 9.51E-06 | mr1462 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218591659 | NA | 1.77E-07 | mr1729 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218591659 | 4.21E-08 | NA | mr1457_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218591659 | 5.68E-06 | 2.50E-08 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218591659 | 3.58E-11 | NA | mr1458_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218591659 | 1.29E-06 | 2.17E-09 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218591659 | NA | 2.04E-06 | mr1458_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218591659 | NA | 5.03E-07 | mr1805_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |