\
| Variant ID: vg1218526657 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18526657 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTACTACTCCATATTAGAACGATAGTATAGGAGAGAGGGACTTGTTCATGCCAAGTAGCATCAATCCCAATAAAAACTATTGTACCTCTAGTGACCATAG[G/A]
AGGATGTCCTTTGCTCATCTGCTTTGGCAGCATCCCATAGTAATGGGGTGAAGTTCTTGGGATTTGGCCCATGGAGCATATGGAACTCGGTAGCATCGTA
TACGATGCTACCGAGTTCCATATGCTCCATGGGCCAAATCCCAAGAACTTCACCCCATTACTATGGGATGCTGCCAAAGCAGATGAGCAAAGGACATCCT[C/T]
CTATGGTCACTAGAGGTACAATAGTTTTTATTGGGATTGATGCTACTTGGCATGAACAAGTCCCTCTCTCCTATACTATCGTTCTAATATGGAGTAGTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.30% | 8.40% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 95.20% | 4.30% | 0.51% | 0.00% | NA |
| All Japonica | 1512 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 25.70% | 74.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.50% | 3.90% | 1.53% | 0.00% | NA |
| Indica Intermediate | 786 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.10% | 19.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218526657 | G -> A | LOC_Os12g30824.1 | missense_variant ; p.Pro33Ser; MODERATE | nonsynonymous_codon ; P33S | Average:43.045; most accessible tissue: Callus, score: 74.494 | benign |
0.173 |
TOLERATED | 0.17 |
| vg1218526657 | G -> A | LOC_Os12g30824.2 | missense_variant ; p.Pro33Ser; MODERATE | nonsynonymous_codon ; P33S | Average:43.045; most accessible tissue: Callus, score: 74.494 | benign |
0.173 |
TOLERATED | 0.17 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218526657 | NA | 1.26E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218526657 | NA | 2.51E-08 | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218526657 | 1.28E-06 | 6.86E-09 | mr1171 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218526657 | NA | 2.24E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218526657 | NA | 7.91E-06 | mr1358 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218526657 | NA | 6.84E-07 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218526657 | NA | 3.96E-06 | mr1427 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218526657 | NA | 6.58E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218526657 | NA | 5.36E-08 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218526657 | NA | 1.71E-08 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218526657 | NA | 9.56E-06 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218526657 | NA | 9.06E-09 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218526657 | NA | 6.03E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218526657 | NA | 2.36E-11 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218526657 | NA | 1.51E-06 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218526657 | NA | 7.44E-08 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218526657 | NA | 1.91E-16 | mr1587_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |