\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218514358:

Variant ID: vg1218514358 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18514358
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


AATCTATCCTGTTCTGAAGTGTCCAGTGTGCGGAGAGGACAAAACCTGATTGATTCTTGAACATATATGGTACCACAATAAGTTTTACTAAATAAGTTCT[G/A]
GTCTTTCTGAGGTCCTATTCCTTTGGTCCACAAATATAAGAGATTCTGGTGAAAGTAATAGCTAGTTGGTATTAATGGAGGAACCCTAATTTCGTAGTAA

Reverse complement sequence

TTACTACGAAATTAGGGTTCCTCCATTAATACCAACTAGCTATTACTTTCACCAGAATCTCTTATATTTGTGGACCAAAGGAATAGGACCTCAGAAAGAC[C/T]
AGAACTTATTTAGTAAAACTTATTGTGGTACCATATATGTTCAAGAATCAATCAGGTTTTGTCCTCTCCGCACACTGGACACTTCAGAACAGGATAGATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.10% 10.70% 16.55% 12.57% NA
All Indica  2759 33.10% 18.10% 27.33% 21.42% NA
All Japonica  1512 99.00% 0.10% 0.79% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 33.90% 16.00% 27.39% 22.69% NA
Indica II  465 28.80% 18.50% 35.70% 16.99% NA
Indica III  913 35.80% 18.90% 21.58% 23.66% NA
Indica Intermediate  786 31.90% 18.60% 29.01% 20.48% NA
Temperate Japonica  767 99.10% 0.10% 0.65% 0.13% NA
Tropical Japonica  504 99.20% 0.00% 0.79% 0.00% NA
Japonica Intermediate  241 98.30% 0.40% 1.24% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 74.40% 6.70% 16.67% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218514358 G -> DEL N N silent_mutation Average:43.574; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1218514358 G -> A LOC_Os12g30824.1 intron_variant ; MODIFIER silent_mutation Average:43.574; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1218514358 G -> A LOC_Os12g30824.2 intron_variant ; MODIFIER silent_mutation Average:43.574; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218514358 5.67E-10 3.78E-21 mr1457 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358 4.99E-08 1.81E-12 mr1457 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358 2.76E-19 4.15E-78 mr1458 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358 9.84E-16 3.67E-28 mr1458 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358 NA 3.09E-07 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358 NA 4.26E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358 NA 9.48E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358 NA 2.47E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358 NA 6.26E-06 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358 NA 2.60E-17 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358 NA 1.25E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358 NA 4.46E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358 2.96E-10 3.74E-32 mr1457_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358 6.32E-08 7.41E-14 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358 5.73E-23 1.28E-87 mr1458_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358 6.46E-20 9.58E-35 mr1458_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358 NA 7.26E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358 NA 1.15E-09 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251