Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218514358:

Variant ID: vg1218514358 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18514358
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:

AATCTATCCTGTTCTGAAGTGTCCAGTGTGCGGAGAGGACAAAACCTGATTGATTCTTGAACATATATGGTACCACAATAAGTTTTACTAAATAAGTTCT[G/A]
GTCTTTCTGAGGTCCTATTCCTTTGGTCCACAAATATAAGAGATTCTGGTGAAAGTAATAGCTAGTTGGTATTAATGGAGGAACCCTAATTTCGTAGTAA

Reverse complement sequence

TTACTACGAAATTAGGGTTCCTCCATTAATACCAACTAGCTATTACTTTCACCAGAATCTCTTATATTTGTGGACCAAAGGAATAGGACCTCAGAAAGAC[C/T]
AGAACTTATTTAGTAAAACTTATTGTGGTACCATATATGTTCAAGAATCAATCAGGTTTTGTCCTCTCCGCACACTGGACACTTCAGAACAGGATAGATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.10%	10.70%	16.55%	12.57%	NA
All Indica	2759	33.10%	18.10%	27.33%	21.42%	NA
All Japonica	1512	99.00%	0.10%	0.79%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	33.90%	16.00%	27.39%	22.69%	NA
Indica II	465	28.80%	18.50%	35.70%	16.99%	NA
Indica III	913	35.80%	18.90%	21.58%	23.66%	NA
Indica Intermediate	786	31.90%	18.60%	29.01%	20.48%	NA
Temperate Japonica	767	99.10%	0.10%	0.65%	0.13%	NA
Tropical Japonica	504	99.20%	0.00%	0.79%	0.00%	NA
Japonica Intermediate	241	98.30%	0.40%	1.24%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	74.40%	6.70%	16.67%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218514358	G -> DEL	N	N	silent_mutation	Average:43.574; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1218514358	G -> A	LOC_Os12g30824.1	intron_variant ; MODIFIER	silent_mutation	Average:43.574; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1218514358	G -> A	LOC_Os12g30824.2	intron_variant ; MODIFIER	silent_mutation	Average:43.574; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218514358	5.67E-10	3.78E-21	mr1457	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358	4.99E-08	1.81E-12	mr1457	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358	2.76E-19	4.15E-78	mr1458	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358	9.84E-16	3.67E-28	mr1458	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358	NA	3.09E-07	mr1686	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358	NA	4.26E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358	NA	9.48E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358	NA	2.47E-09	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358	NA	6.26E-06	mr1296_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358	NA	2.60E-17	mr1352_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358	NA	1.25E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358	NA	4.46E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358	2.96E-10	3.74E-32	mr1457_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358	6.32E-08	7.41E-14	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358	5.73E-23	1.28E-87	mr1458_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358	6.46E-20	9.58E-35	mr1458_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358	NA	7.26E-06	mr1882_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218514358	NA	1.15E-09	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251