Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218466305:

Variant ID: vg1218466305 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18466305
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATCAGATGGTTGATAATAGTGGGCCTACCGATTTAAATGAAAATCAATGGTTAGATTTTTTAATTGCCACGTGGCAATTTGAGAGCGTTTTAAGGAGTG[C/T]
CATGTGGTGGCTTGAGAATGTTTCTAAAAAGTTTAATAGATTTTTAGTATATAATAGATAGATAGATAGATACCCTTGTGCAACATGTCCTTCAAATGAT

Reverse complement sequence

ATCATTTGAAGGACATGTTGCACAAGGGTATCTATCTATCTATCTATTATATACTAAAAATCTATTAAACTTTTTAGAAACATTCTCAAGCCACCACATG[G/A]
CACTCCTTAAAACGCTCTCAAATTGCCACGTGGCAATTAAAAAATCTAACCATTGATTTTCATTTAAATCGGTAGGCCCACTATTATCAACCATCTGATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.90%	6.30%	0.70%	60.18%	NA
All Indica	2759	34.80%	2.10%	0.43%	62.67%	NA
All Japonica	1512	34.50%	5.40%	0.60%	59.59%	NA
Aus	269	5.60%	55.00%	2.97%	36.43%	NA
Indica I	595	56.60%	1.20%	0.67%	41.51%	NA
Indica II	465	20.40%	0.20%	0.43%	78.92%	NA
Indica III	913	28.60%	3.30%	0.22%	67.91%	NA
Indica Intermediate	786	33.80%	2.70%	0.51%	62.98%	NA
Temperate Japonica	767	59.20%	0.30%	0.39%	40.16%	NA
Tropical Japonica	504	3.00%	4.00%	0.60%	92.46%	NA
Japonica Intermediate	241	21.60%	24.50%	1.24%	52.70%	NA
VI/Aromatic	96	15.60%	4.20%	1.04%	79.17%	NA
Intermediate	90	47.80%	4.40%	3.33%	44.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218466305	C -> DEL	N	N	silent_mutation	Average:10.676; most accessible tissue: Callus, score: 51.562	N	N	N	N
vg1218466305	C -> T	LOC_Os12g30750.1	upstream_gene_variant ; 1191.0bp to feature; MODIFIER	silent_mutation	Average:10.676; most accessible tissue: Callus, score: 51.562	N	N	N	N
vg1218466305	C -> T	LOC_Os12g30740.1	downstream_gene_variant ; 4589.0bp to feature; MODIFIER	silent_mutation	Average:10.676; most accessible tissue: Callus, score: 51.562	N	N	N	N
vg1218466305	C -> T	LOC_Os12g30760.1	downstream_gene_variant ; 2908.0bp to feature; MODIFIER	silent_mutation	Average:10.676; most accessible tissue: Callus, score: 51.562	N	N	N	N
vg1218466305	C -> T	LOC_Os12g30750-LOC_Os12g30760	intergenic_region ; MODIFIER	silent_mutation	Average:10.676; most accessible tissue: Callus, score: 51.562	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218466305	2.56E-07	5.88E-19	mr1117	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305	1.16E-06	NA	mr1118	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305	4.91E-06	NA	mr1123	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305	NA	8.76E-08	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305	1.33E-08	NA	mr1242	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305	2.31E-06	NA	mr1247	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305	NA	5.70E-08	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305	NA	1.03E-09	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305	NA	3.94E-14	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305	NA	1.95E-07	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305	4.32E-06	NA	mr1113_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305	3.01E-06	NA	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305	5.90E-06	NA	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305	6.08E-06	NA	mr1120_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305	6.20E-06	NA	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305	2.19E-06	NA	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305	1.31E-06	NA	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305	8.50E-07	9.69E-15	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251