\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218466305:

Variant ID: vg1218466305 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18466305
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATCAGATGGTTGATAATAGTGGGCCTACCGATTTAAATGAAAATCAATGGTTAGATTTTTTAATTGCCACGTGGCAATTTGAGAGCGTTTTAAGGAGTG[C/T]
CATGTGGTGGCTTGAGAATGTTTCTAAAAAGTTTAATAGATTTTTAGTATATAATAGATAGATAGATAGATACCCTTGTGCAACATGTCCTTCAAATGAT

Reverse complement sequence

ATCATTTGAAGGACATGTTGCACAAGGGTATCTATCTATCTATCTATTATATACTAAAAATCTATTAAACTTTTTAGAAACATTCTCAAGCCACCACATG[G/A]
CACTCCTTAAAACGCTCTCAAATTGCCACGTGGCAATTAAAAAATCTAACCATTGATTTTCATTTAAATCGGTAGGCCCACTATTATCAACCATCTGATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.90% 6.30% 0.70% 60.18% NA
All Indica  2759 34.80% 2.10% 0.43% 62.67% NA
All Japonica  1512 34.50% 5.40% 0.60% 59.59% NA
Aus  269 5.60% 55.00% 2.97% 36.43% NA
Indica I  595 56.60% 1.20% 0.67% 41.51% NA
Indica II  465 20.40% 0.20% 0.43% 78.92% NA
Indica III  913 28.60% 3.30% 0.22% 67.91% NA
Indica Intermediate  786 33.80% 2.70% 0.51% 62.98% NA
Temperate Japonica  767 59.20% 0.30% 0.39% 40.16% NA
Tropical Japonica  504 3.00% 4.00% 0.60% 92.46% NA
Japonica Intermediate  241 21.60% 24.50% 1.24% 52.70% NA
VI/Aromatic  96 15.60% 4.20% 1.04% 79.17% NA
Intermediate  90 47.80% 4.40% 3.33% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218466305 C -> DEL N N silent_mutation Average:10.676; most accessible tissue: Callus, score: 51.562 N N N N
vg1218466305 C -> T LOC_Os12g30750.1 upstream_gene_variant ; 1191.0bp to feature; MODIFIER silent_mutation Average:10.676; most accessible tissue: Callus, score: 51.562 N N N N
vg1218466305 C -> T LOC_Os12g30740.1 downstream_gene_variant ; 4589.0bp to feature; MODIFIER silent_mutation Average:10.676; most accessible tissue: Callus, score: 51.562 N N N N
vg1218466305 C -> T LOC_Os12g30760.1 downstream_gene_variant ; 2908.0bp to feature; MODIFIER silent_mutation Average:10.676; most accessible tissue: Callus, score: 51.562 N N N N
vg1218466305 C -> T LOC_Os12g30750-LOC_Os12g30760 intergenic_region ; MODIFIER silent_mutation Average:10.676; most accessible tissue: Callus, score: 51.562 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218466305 2.56E-07 5.88E-19 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305 1.16E-06 NA mr1118 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305 4.91E-06 NA mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305 NA 8.76E-08 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305 1.33E-08 NA mr1242 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305 2.31E-06 NA mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305 NA 5.70E-08 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305 NA 1.03E-09 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305 NA 3.94E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305 NA 1.95E-07 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305 4.32E-06 NA mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305 3.01E-06 NA mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305 5.90E-06 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305 6.08E-06 NA mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305 6.20E-06 NA mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305 2.19E-06 NA mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305 1.31E-06 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218466305 8.50E-07 9.69E-15 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251