\
| Variant ID: vg1218416620 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18416620 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 97. )
AGGGTCGTGAAGGAGAAGGTTGCCAGGTGGAAGGAAAGCGACGCCGGACTAGACATGGCCGCCGAGGAAGGAGCAGAGCCTTCGGCGCCCACTGCCGAAG[A/T]
TGGAGGAGGACAAGCGACATCACAACTGCCTTCGGCCCCTGCAACCTCCGTGCAAGTGCCGAACGCGGCCGACGTGGCGAAGGCGGCTGCGGCGGCAAGG
CCTTGCCGCCGCAGCCGCCTTCGCCACGTCGGCCGCGTTCGGCACTTGCACGGAGGTTGCAGGGGCCGAAGGCAGTTGTGATGTCGCTTGTCCTCCTCCA[T/A]
CTTCGGCAGTGGGCGCCGAAGGCTCTGCTCCTTCCTCGGCGGCCATGTCTAGTCCGGCGTCGCTTTCCTTCCACCTGGCAACCTTCTCCTTCACGACCCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.90% | 20.60% | 1.44% | 29.07% | NA |
| All Indica | 2759 | 23.10% | 34.90% | 2.36% | 39.65% | NA |
| All Japonica | 1512 | 98.20% | 0.10% | 0.00% | 1.72% | NA |
| Aus | 269 | 14.10% | 0.70% | 1.12% | 84.01% | NA |
| Indica I | 595 | 38.50% | 20.30% | 0.67% | 40.50% | NA |
| Indica II | 465 | 28.20% | 20.90% | 2.80% | 48.17% | NA |
| Indica III | 913 | 9.50% | 53.60% | 2.41% | 34.50% | NA |
| Indica Intermediate | 786 | 24.20% | 32.60% | 3.31% | 39.95% | NA |
| Temperate Japonica | 767 | 98.80% | 0.00% | 0.00% | 1.17% | NA |
| Tropical Japonica | 504 | 99.00% | 0.20% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 94.60% | 0.00% | 0.00% | 5.39% | NA |
| VI/Aromatic | 96 | 82.30% | 1.00% | 0.00% | 16.67% | NA |
| Intermediate | 90 | 77.80% | 8.90% | 0.00% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218416620 | A -> DEL | LOC_Os12g30660.1 | N | frameshift_variant | Average:42.665; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 | N | N | N | N |
| vg1218416620 | A -> T | LOC_Os12g30660.1 | missense_variant ; p.Asp16Val; MODERATE | nonsynonymous_codon ; D16V | Average:42.665; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 | possibly damaging |
1.86 |
TOLERATED | 0.07 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218416620 | NA | 8.99E-06 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218416620 | NA | 3.07E-11 | mr1425 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218416620 | NA | 2.65E-09 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218416620 | NA | 1.29E-06 | mr1851 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218416620 | NA | 6.69E-08 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218416620 | NA | 4.05E-08 | mr1539_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218416620 | 1.14E-06 | NA | mr1540_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218416620 | 1.57E-06 | 8.41E-12 | mr1540_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218416620 | 4.37E-06 | NA | mr1732_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218416620 | 4.64E-06 | 1.07E-10 | mr1732_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218416620 | NA | 2.17E-06 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218416620 | NA | 2.50E-06 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |