\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218395203:

Variant ID: vg1218395203 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 18395203
Reference Allele: GAlternative Allele: A,GTTAGT
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TTAATTAGCTCGGCCGCCGGAGAGAAATCGCCAAGTTCACCGGCCGCCGTACGTAGCGTAGCTTCTCCTCATTCAAAACTGAAGTTAATTATACCTTCGA[G/A,GTTAGT]
TTCACCATGCCACGTTCTACAAAACCCACACAACTTCCTCGATCGCCATGATCGATTGCCGCTGGAACCTCGCCGTGCGAGTGCGACGCGACCCCCCCCA

Reverse complement sequence

TGGGGGGGGTCGCGTCGCACTCGCACGGCGAGGTTCCAGCGGCAATCGATCATGGCGATCGAGGAAGTTGTGTGGGTTTTGTAGAACGTGGCATGGTGAA[C/T,ACTAAC]
TCGAAGGTATAATTAACTTCAGTTTTGAATGAGGAGAAGCTACGCTACGTACGGCGGCCGGTGAACTTGGCGATTTCTCTCCGGCGGCCGAGCTAATTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.40% 20.00% 0.57% 0.00% GTTAGT: 0.06%
All Indica  2759 66.40% 32.60% 0.98% 0.00% GTTAGT: 0.04%
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 46.10% 53.30% 0.67% 0.00% NA
Indica II  465 83.00% 16.30% 0.65% 0.00% NA
Indica III  913 70.60% 29.00% 0.33% 0.00% NA
Indica Intermediate  786 66.90% 30.80% 2.16% 0.00% GTTAGT: 0.13%
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 88.90% 8.90% 0.00% 0.00% GTTAGT: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218395203 G -> A LOC_Os12g30630.1 upstream_gene_variant ; 268.0bp to feature; MODIFIER silent_mutation Average:60.318; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg1218395203 G -> A LOC_Os12g30620.1 downstream_gene_variant ; 4147.0bp to feature; MODIFIER silent_mutation Average:60.318; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg1218395203 G -> A LOC_Os12g30620.2 downstream_gene_variant ; 4117.0bp to feature; MODIFIER silent_mutation Average:60.318; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg1218395203 G -> A LOC_Os12g30620-LOC_Os12g30630 intergenic_region ; MODIFIER silent_mutation Average:60.318; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg1218395203 G -> GTTAGT LOC_Os12g30630.1 upstream_gene_variant ; 267.0bp to feature; MODIFIER silent_mutation Average:60.318; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg1218395203 G -> GTTAGT LOC_Os12g30620.1 downstream_gene_variant ; 4148.0bp to feature; MODIFIER silent_mutation Average:60.318; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg1218395203 G -> GTTAGT LOC_Os12g30620.2 downstream_gene_variant ; 4118.0bp to feature; MODIFIER silent_mutation Average:60.318; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg1218395203 G -> GTTAGT LOC_Os12g30620-LOC_Os12g30630 intergenic_region ; MODIFIER silent_mutation Average:60.318; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218395203 1.93E-06 NA mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218395203 NA 1.65E-12 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218395203 NA 1.71E-07 mr1542 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218395203 NA 1.54E-08 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218395203 NA 1.82E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218395203 NA 2.50E-06 mr1061_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218395203 NA 7.15E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218395203 NA 7.03E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218395203 NA 2.00E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218395203 NA 2.29E-06 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218395203 NA 4.97E-06 mr1421_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218395203 NA 9.89E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218395203 NA 4.93E-08 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218395203 NA 5.16E-06 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218395203 NA 4.69E-07 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218395203 NA 9.71E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218395203 NA 4.14E-15 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218395203 NA 1.96E-13 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251