| Variant ID: vg1218267405 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18267405 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.60, T: 0.41, others allele: 0.00, population size: 86. )
TTCAACATAAAATAAAGAAACTATCAAAATGAATTCAATGTTTATTTAATAAAACTAATTTAATGCTATAAATGTTGTTATATTTTTCTATAAACTAGGT[C/T]
AAACAATAAAAAGATTGTTTTTACAAAAGTGAAAGCAATATATAATATAAAACAGATGATACGGAGGGAGTAGTTTATTAGAAGGGTTAGGTTTGGAAAA
TTTTCCAAACCTAACCCTTCTAATAAACTACTCCCTCCGTATCATCTGTTTTATATTATATATTGCTTTCACTTTTGTAAAAACAATCTTTTTATTGTTT[G/A]
ACCTAGTTTATAGAAAAATATAACAACATTTATAGCATTAAATTAGTTTTATTAAATAAACATTGAATTCATTTTGATAGTTTCTTTATTTTATGTTGAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.90% | 30.70% | 0.30% | 18.11% | NA |
| All Indica | 2759 | 70.10% | 28.20% | 0.18% | 1.52% | NA |
| All Japonica | 1512 | 14.60% | 36.90% | 0.33% | 48.21% | NA |
| Aus | 269 | 73.20% | 21.20% | 1.12% | 4.46% | NA |
| Indica I | 595 | 56.60% | 41.30% | 0.34% | 1.68% | NA |
| Indica II | 465 | 69.00% | 30.50% | 0.00% | 0.43% | NA |
| Indica III | 913 | 79.40% | 19.70% | 0.22% | 0.66% | NA |
| Indica Intermediate | 786 | 70.00% | 26.80% | 0.13% | 3.05% | NA |
| Temperate Japonica | 767 | 2.00% | 63.50% | 0.39% | 34.16% | NA |
| Tropical Japonica | 504 | 25.60% | 2.80% | 0.40% | 71.23% | NA |
| Japonica Intermediate | 241 | 31.50% | 23.70% | 0.00% | 44.81% | NA |
| VI/Aromatic | 96 | 25.00% | 15.60% | 1.04% | 58.33% | NA |
| Intermediate | 90 | 36.70% | 44.40% | 0.00% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218267405 | C -> DEL | N | N | silent_mutation | Average:19.425; most accessible tissue: Callus, score: 30.527 | N | N | N | N |
| vg1218267405 | C -> T | LOC_Os12g30444.1 | downstream_gene_variant ; 4276.0bp to feature; MODIFIER | silent_mutation | Average:19.425; most accessible tissue: Callus, score: 30.527 | N | N | N | N |
| vg1218267405 | C -> T | LOC_Os12g30440-LOC_Os12g30444 | intergenic_region ; MODIFIER | silent_mutation | Average:19.425; most accessible tissue: Callus, score: 30.527 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218267405 | NA | 2.90E-09 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218267405 | NA | 7.57E-06 | mr1333 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218267405 | 8.18E-06 | NA | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218267405 | NA | 1.27E-11 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218267405 | NA | 5.40E-06 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218267405 | NA | 6.42E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218267405 | NA | 2.68E-06 | mr1686 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218267405 | 1.65E-07 | NA | mr1458_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218267405 | 1.14E-06 | 2.62E-13 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218267405 | NA | 3.42E-06 | mr1790_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |