Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1218267405:

Variant ID: vg1218267405 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18267405
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.60, T: 0.41, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

TTCAACATAAAATAAAGAAACTATCAAAATGAATTCAATGTTTATTTAATAAAACTAATTTAATGCTATAAATGTTGTTATATTTTTCTATAAACTAGGT[C/T]
AAACAATAAAAAGATTGTTTTTACAAAAGTGAAAGCAATATATAATATAAAACAGATGATACGGAGGGAGTAGTTTATTAGAAGGGTTAGGTTTGGAAAA

Reverse complement sequence

TTTTCCAAACCTAACCCTTCTAATAAACTACTCCCTCCGTATCATCTGTTTTATATTATATATTGCTTTCACTTTTGTAAAAACAATCTTTTTATTGTTT[G/A]
ACCTAGTTTATAGAAAAATATAACAACATTTATAGCATTAAATTAGTTTTATTAAATAAACATTGAATTCATTTTGATAGTTTCTTTATTTTATGTTGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.90%	30.70%	0.30%	18.11%	NA
All Indica	2759	70.10%	28.20%	0.18%	1.52%	NA
All Japonica	1512	14.60%	36.90%	0.33%	48.21%	NA
Aus	269	73.20%	21.20%	1.12%	4.46%	NA
Indica I	595	56.60%	41.30%	0.34%	1.68%	NA
Indica II	465	69.00%	30.50%	0.00%	0.43%	NA
Indica III	913	79.40%	19.70%	0.22%	0.66%	NA
Indica Intermediate	786	70.00%	26.80%	0.13%	3.05%	NA
Temperate Japonica	767	2.00%	63.50%	0.39%	34.16%	NA
Tropical Japonica	504	25.60%	2.80%	0.40%	71.23%	NA
Japonica Intermediate	241	31.50%	23.70%	0.00%	44.81%	NA
VI/Aromatic	96	25.00%	15.60%	1.04%	58.33%	NA
Intermediate	90	36.70%	44.40%	0.00%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218267405	C -> DEL	N	N	silent_mutation	Average:19.425; most accessible tissue: Callus, score: 30.527	N	N	N	N
vg1218267405	C -> T	LOC_Os12g30444.1	downstream_gene_variant ; 4276.0bp to feature; MODIFIER	silent_mutation	Average:19.425; most accessible tissue: Callus, score: 30.527	N	N	N	N
vg1218267405	C -> T	LOC_Os12g30440-LOC_Os12g30444	intergenic_region ; MODIFIER	silent_mutation	Average:19.425; most accessible tissue: Callus, score: 30.527	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218267405	NA	2.90E-09	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218267405	NA	7.57E-06	mr1333	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218267405	8.18E-06	NA	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218267405	NA	1.27E-11	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218267405	NA	5.40E-06	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218267405	NA	6.42E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218267405	NA	2.68E-06	mr1686	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218267405	1.65E-07	NA	mr1458_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218267405	1.14E-06	2.62E-13	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218267405	NA	3.42E-06	mr1790_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251