\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218267405:

Variant ID: vg1218267405 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18267405
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.60, T: 0.41, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAACATAAAATAAAGAAACTATCAAAATGAATTCAATGTTTATTTAATAAAACTAATTTAATGCTATAAATGTTGTTATATTTTTCTATAAACTAGGT[C/T]
AAACAATAAAAAGATTGTTTTTACAAAAGTGAAAGCAATATATAATATAAAACAGATGATACGGAGGGAGTAGTTTATTAGAAGGGTTAGGTTTGGAAAA

Reverse complement sequence

TTTTCCAAACCTAACCCTTCTAATAAACTACTCCCTCCGTATCATCTGTTTTATATTATATATTGCTTTCACTTTTGTAAAAACAATCTTTTTATTGTTT[G/A]
ACCTAGTTTATAGAAAAATATAACAACATTTATAGCATTAAATTAGTTTTATTAAATAAACATTGAATTCATTTTGATAGTTTCTTTATTTTATGTTGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.90% 30.70% 0.30% 18.11% NA
All Indica  2759 70.10% 28.20% 0.18% 1.52% NA
All Japonica  1512 14.60% 36.90% 0.33% 48.21% NA
Aus  269 73.20% 21.20% 1.12% 4.46% NA
Indica I  595 56.60% 41.30% 0.34% 1.68% NA
Indica II  465 69.00% 30.50% 0.00% 0.43% NA
Indica III  913 79.40% 19.70% 0.22% 0.66% NA
Indica Intermediate  786 70.00% 26.80% 0.13% 3.05% NA
Temperate Japonica  767 2.00% 63.50% 0.39% 34.16% NA
Tropical Japonica  504 25.60% 2.80% 0.40% 71.23% NA
Japonica Intermediate  241 31.50% 23.70% 0.00% 44.81% NA
VI/Aromatic  96 25.00% 15.60% 1.04% 58.33% NA
Intermediate  90 36.70% 44.40% 0.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218267405 C -> DEL N N silent_mutation Average:19.425; most accessible tissue: Callus, score: 30.527 N N N N
vg1218267405 C -> T LOC_Os12g30444.1 downstream_gene_variant ; 4276.0bp to feature; MODIFIER silent_mutation Average:19.425; most accessible tissue: Callus, score: 30.527 N N N N
vg1218267405 C -> T LOC_Os12g30440-LOC_Os12g30444 intergenic_region ; MODIFIER silent_mutation Average:19.425; most accessible tissue: Callus, score: 30.527 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218267405 NA 2.90E-09 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218267405 NA 7.57E-06 mr1333 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218267405 8.18E-06 NA mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218267405 NA 1.27E-11 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218267405 NA 5.40E-06 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218267405 NA 6.42E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218267405 NA 2.68E-06 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218267405 1.65E-07 NA mr1458_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218267405 1.14E-06 2.62E-13 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218267405 NA 3.42E-06 mr1790_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251