\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218169300:

Variant ID: vg1218169300 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18169300
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TGCGTTGAATCCCACACTCCTAGCAGGCGTAGAGTTCAGCTTTCACGTGGAGTATCACCGGGCAATCCTCGAGAATATACTTGGATGTCAGCTTTTAGGT[A/G]
GTATTCCTTGTCAGCTCTGGTTTTTGTACAAGGGACGAAATTCGGCCATTTGAGGATTTTTCCCAAGTGTTGGGACCGTCGATGTTCCGTTCTCCACTTG

Reverse complement sequence

CAAGTGGAGAACGGAACATCGACGGTCCCAACACTTGGGAAAAATCCTCAAATGGCCGAATTTCGTCCCTTGTACAAAAACCAGAGCTGACAAGGAATAC[T/C]
ACCTAAAAGCTGACATCCAAGTATATTCTCGAGGATTGCCCGGTGATACTCCACGTGAAAGCTGAACTCTACGCCTGCTAGGAGTGTGGGATTCAACGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.30% 35.10% 2.98% 21.58% NA
All Indica  2759 59.90% 4.10% 3.77% 32.22% NA
All Japonica  1512 9.30% 86.80% 1.65% 2.31% NA
Aus  269 30.10% 37.50% 1.49% 30.86% NA
Indica I  595 89.70% 2.70% 0.84% 6.72% NA
Indica II  465 53.30% 2.20% 4.09% 40.43% NA
Indica III  913 48.70% 3.60% 5.04% 42.61% NA
Indica Intermediate  786 54.20% 6.90% 4.33% 34.61% NA
Temperate Japonica  767 1.20% 95.30% 2.09% 1.43% NA
Tropical Japonica  504 20.60% 74.80% 0.99% 3.57% NA
Japonica Intermediate  241 11.20% 84.60% 1.66% 2.49% NA
VI/Aromatic  96 9.40% 81.20% 3.12% 6.25% NA
Intermediate  90 23.30% 63.30% 5.56% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218169300 A -> DEL N N silent_mutation Average:45.178; most accessible tissue: Callus, score: 58.158 N N N N
vg1218169300 A -> G LOC_Os12g30280.1 upstream_gene_variant ; 3551.0bp to feature; MODIFIER silent_mutation Average:45.178; most accessible tissue: Callus, score: 58.158 N N N N
vg1218169300 A -> G LOC_Os12g30290.1 upstream_gene_variant ; 256.0bp to feature; MODIFIER silent_mutation Average:45.178; most accessible tissue: Callus, score: 58.158 N N N N
vg1218169300 A -> G LOC_Os12g30290-LOC_Os12g30310 intergenic_region ; MODIFIER silent_mutation Average:45.178; most accessible tissue: Callus, score: 58.158 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218169300 NA 7.33E-07 mr1030 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 NA 4.50E-07 mr1157 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 NA 2.84E-07 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 4.22E-06 NA mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 8.71E-07 4.62E-08 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 NA 1.63E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 5.07E-07 5.99E-07 mr1325 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 2.88E-06 9.07E-06 mr1326 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 NA 1.17E-07 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 NA 2.56E-06 mr1333 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 7.76E-06 2.58E-07 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 NA 1.98E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 3.96E-06 NA mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 NA 3.85E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 5.78E-06 1.90E-08 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 NA 2.24E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 NA 2.04E-07 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 NA 1.82E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 NA 8.58E-07 mr1570 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 NA 1.54E-06 mr1621 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 6.85E-06 1.92E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 NA 3.17E-10 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 NA 2.44E-06 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 6.98E-06 1.08E-08 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 NA 7.85E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 NA 1.33E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 4.18E-07 2.31E-08 mr1965 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 4.63E-06 4.63E-06 mr1966 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 NA 1.03E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218169300 NA 7.28E-06 mr1910_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251