Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1218165901:

Variant ID: vg1218165901 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18165901
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

CCAGTCGGCTACGAAGTCAGCTAAGACAGTCCAGTCGGCTACGAAGTCAGCTAAGACTTGGCTGTCCTTGGTACAAACTGTACATAAAACTGGCTTAAAT[C/T]
GACTACCCATTTAGCAATGCGGCCGACGACGTCTTTGTTTCTGACAACTTCCCCTAAAGGGAAAGAGGAGACGACCATGACCTTGTGAGCTTGGAAGTAG

Reverse complement sequence

CTACTTCCAAGCTCACAAGGTCATGGTCGTCTCCTCTTTCCCTTTAGGGGAAGTTGTCAGAAACAAAGACGTCGTCGGCCGCATTGCTAAATGGGTAGTC[G/A]
ATTTAAGCCAGTTTTATGTACAGTTTGTACCAAGGACAGCCAAGTCTTAGCTGACTTCGTAGCCGACTGGACTGTCTTAGCTGACTTCGTAGCCGACTGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.70%	6.60%	3.11%	19.53%	NA
All Indica	2759	62.50%	2.70%	4.82%	29.97%	NA
All Japonica	1512	87.60%	12.00%	0.00%	0.33%	NA
Aus	269	56.50%	10.80%	4.09%	28.62%	NA
Indica I	595	92.80%	0.00%	0.17%	7.06%	NA
Indica II	465	48.40%	9.20%	8.17%	34.19%	NA
Indica III	913	51.60%	1.80%	5.91%	40.74%	NA
Indica Intermediate	786	60.70%	1.90%	5.09%	32.32%	NA
Temperate Japonica	767	99.10%	0.40%	0.00%	0.52%	NA
Tropical Japonica	504	76.80%	23.20%	0.00%	0.00%	NA
Japonica Intermediate	241	73.90%	25.70%	0.00%	0.41%	NA
VI/Aromatic	96	72.90%	18.80%	0.00%	8.33%	NA
Intermediate	90	78.90%	11.10%	3.33%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218165901	C -> DEL	N	N	silent_mutation	Average:48.478; most accessible tissue: Minghui63 flag leaf, score: 66.556	N	N	N	N
vg1218165901	C -> T	LOC_Os12g30280.1	upstream_gene_variant ; 152.0bp to feature; MODIFIER	silent_mutation	Average:48.478; most accessible tissue: Minghui63 flag leaf, score: 66.556	N	N	N	N
vg1218165901	C -> T	LOC_Os12g30270.1	downstream_gene_variant ; 2751.0bp to feature; MODIFIER	silent_mutation	Average:48.478; most accessible tissue: Minghui63 flag leaf, score: 66.556	N	N	N	N
vg1218165901	C -> T	LOC_Os12g30290.1	downstream_gene_variant ; 238.0bp to feature; MODIFIER	silent_mutation	Average:48.478; most accessible tissue: Minghui63 flag leaf, score: 66.556	N	N	N	N
vg1218165901	C -> T	LOC_Os12g30280-LOC_Os12g30290	intergenic_region ; MODIFIER	silent_mutation	Average:48.478; most accessible tissue: Minghui63 flag leaf, score: 66.556	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218165901	9.81E-06	NA	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165901	NA	1.12E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165901	1.54E-06	NA	mr1403	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165901	NA	3.33E-07	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165901	3.28E-06	NA	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218165901	1.94E-06	1.94E-06	mr1823	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251