\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218162368:

Variant ID: vg1218162368 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18162368
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, C: 0.06, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CACCCTAACGTGACCTCTCTGACATCGGTGCTTGGCGAATTGGCAACAAAGATGGAGGCCATCCCGTCGAAGCATGTCGCCAGGGTCTTGGAGGAGATCT[G/C]
CAACGGGATCCACACTGGGGTTTGTCATGTCCTCTCTTGTGTGAAGCTAGCTCTCCCCAACGTCGATCTTAAAGAGATCTTATCGAAGGGGGCTGCTGAT

Reverse complement sequence

ATCAGCAGCCCCCTTCGATAAGATCTCTTTAAGATCGACGTTGGGGAGAGCTAGCTTCACACAAGAGAGGACATGACAAACCCCAGTGTGGATCCCGTTG[C/G]
AGATCTCCTCCAAGACCCTGGCGACATGCTTCGACGGGATGGCCTCCATCTTTGTTGCCAATTCGCCAAGCACCGATGTCAGAGAGGTCACGTTAGGGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.90% 32.30% 1.29% 24.50% NA
All Indica  2759 56.60% 3.30% 1.88% 38.24% NA
All Japonica  1512 14.00% 85.60% 0.00% 0.40% NA
Aus  269 59.50% 8.20% 2.60% 29.74% NA
Indica I  595 88.90% 3.20% 0.00% 7.90% NA
Indica II  465 34.00% 1.90% 3.66% 60.43% NA
Indica III  913 50.60% 1.50% 2.96% 44.91% NA
Indica Intermediate  786 52.40% 6.20% 1.02% 40.33% NA
Temperate Japonica  767 1.40% 98.00% 0.00% 0.52% NA
Tropical Japonica  504 24.60% 75.40% 0.00% 0.00% NA
Japonica Intermediate  241 31.50% 67.60% 0.00% 0.83% NA
VI/Aromatic  96 22.90% 68.80% 0.00% 8.33% NA
Intermediate  90 31.10% 56.70% 2.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218162368 G -> C LOC_Os12g30270.1 missense_variant ; p.Cys309Ser; MODERATE nonsynonymous_codon ; C309S Average:48.883; most accessible tissue: Minghui63 young leaf, score: 78.821 unknown unknown TOLERATED 1.00
vg1218162368 G -> DEL LOC_Os12g30270.1 N frameshift_variant Average:48.883; most accessible tissue: Minghui63 young leaf, score: 78.821 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218162368 NA 4.16E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 8.59E-07 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 2.87E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 8.54E-06 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 2.80E-08 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 7.69E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 4.10E-06 NA mr1297 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 6.15E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 5.20E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 5.49E-07 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 6.23E-07 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 9.25E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 1.66E-06 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 6.16E-06 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 4.90E-09 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 9.52E-07 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 1.26E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 7.20E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 7.20E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 6.47E-07 mr1819 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 1.19E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 8.56E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 1.13E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 1.23E-12 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 6.30E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 1.16E-06 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 3.24E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368 NA 1.20E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251