Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218162368:

Variant ID: vg1218162368 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18162368
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, C: 0.06, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

CACCCTAACGTGACCTCTCTGACATCGGTGCTTGGCGAATTGGCAACAAAGATGGAGGCCATCCCGTCGAAGCATGTCGCCAGGGTCTTGGAGGAGATCT[G/C]
CAACGGGATCCACACTGGGGTTTGTCATGTCCTCTCTTGTGTGAAGCTAGCTCTCCCCAACGTCGATCTTAAAGAGATCTTATCGAAGGGGGCTGCTGAT

Reverse complement sequence

ATCAGCAGCCCCCTTCGATAAGATCTCTTTAAGATCGACGTTGGGGAGAGCTAGCTTCACACAAGAGAGGACATGACAAACCCCAGTGTGGATCCCGTTG[C/G]
AGATCTCCTCCAAGACCCTGGCGACATGCTTCGACGGGATGGCCTCCATCTTTGTTGCCAATTCGCCAAGCACCGATGTCAGAGAGGTCACGTTAGGGTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.90%	32.30%	1.29%	24.50%	NA
All Indica	2759	56.60%	3.30%	1.88%	38.24%	NA
All Japonica	1512	14.00%	85.60%	0.00%	0.40%	NA
Aus	269	59.50%	8.20%	2.60%	29.74%	NA
Indica I	595	88.90%	3.20%	0.00%	7.90%	NA
Indica II	465	34.00%	1.90%	3.66%	60.43%	NA
Indica III	913	50.60%	1.50%	2.96%	44.91%	NA
Indica Intermediate	786	52.40%	6.20%	1.02%	40.33%	NA
Temperate Japonica	767	1.40%	98.00%	0.00%	0.52%	NA
Tropical Japonica	504	24.60%	75.40%	0.00%	0.00%	NA
Japonica Intermediate	241	31.50%	67.60%	0.00%	0.83%	NA
VI/Aromatic	96	22.90%	68.80%	0.00%	8.33%	NA
Intermediate	90	31.10%	56.70%	2.22%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218162368	G -> C	LOC_Os12g30270.1	missense_variant ; p.Cys309Ser; MODERATE	nonsynonymous_codon ; C309S	Average:48.883; most accessible tissue: Minghui63 young leaf, score: 78.821	unknown	unknown	TOLERATED	1.00
vg1218162368	G -> DEL	LOC_Os12g30270.1	N	frameshift_variant	Average:48.883; most accessible tissue: Minghui63 young leaf, score: 78.821	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218162368	NA	4.16E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	8.59E-07	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	2.87E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	8.54E-06	mr1224	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	2.80E-08	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	7.69E-09	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	4.10E-06	NA	mr1297	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	6.15E-09	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	5.20E-06	mr1405	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	5.49E-07	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	6.23E-07	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	9.25E-06	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	1.66E-06	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	6.16E-06	mr1602	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	4.90E-09	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	9.52E-07	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	1.26E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	7.20E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	7.20E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	6.47E-07	mr1819	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	1.19E-06	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	8.56E-09	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	1.13E-07	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	1.23E-12	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	6.30E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	1.16E-06	mr1992	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	3.24E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218162368	NA	1.20E-07	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251