\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218153763:

Variant ID: vg1218153763 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18153763
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


GTGTTGCTGACCCGGACTCCTCCGGGAATGGGGAGACCCTTCAACTGAGCATTCTCCTTCTTCAAGCGTGCTATCTTATCCTTCAGAGCTATGATCCTCA[C/T]
GAGCTTCCCGTCATTCAAGGCCTTGGACGCCTAACGCATATCTGAGTGCATCCTGTCCATTCCCCTCATTACGGCACACATGTGACCAAAGGTGGTGTCG

Reverse complement sequence

CGACACCACCTTTGGTCACATGTGTGCCGTAATGAGGGGAATGGACAGGATGCACTCAGATATGCGTTAGGCGTCCAAGGCCTTGAATGACGGGAAGCTC[G/A]
TGAGGATCATAGCTCTGAAGGATAAGATAGCACGCTTGAAGAAGGAGAATGCTCAGTTGAAGGGTCTCCCCATTCCCGGAGGAGTCCGGGTCAGCAACAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.20% 5.20% 1.18% 21.43% NA
All Indica  2759 61.10% 4.00% 1.92% 32.98% NA
All Japonica  1512 91.70% 7.90% 0.00% 0.33% NA
Aus  269 64.30% 3.70% 1.12% 30.86% NA
Indica I  595 87.90% 5.50% 0.67% 5.88% NA
Indica II  465 46.50% 9.20% 2.37% 41.94% NA
Indica III  913 50.40% 2.30% 2.41% 44.91% NA
Indica Intermediate  786 62.00% 1.70% 2.04% 34.35% NA
Temperate Japonica  767 98.70% 0.80% 0.00% 0.52% NA
Tropical Japonica  504 80.40% 19.60% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.20% 0.00% 0.41% NA
VI/Aromatic  96 88.50% 4.20% 0.00% 7.29% NA
Intermediate  90 90.00% 1.10% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218153763 C -> DEL LOC_Os12g30260.1 N frameshift_variant Average:54.961; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg1218153763 C -> T LOC_Os12g30260.1 missense_variant ; p.Val193Met; MODERATE nonsynonymous_codon ; V193M Average:54.961; most accessible tissue: Minghui63 young leaf, score: 73.49 benign 0.408 TOLERATED 0.91

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218153763 NA 4.46E-07 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 2.17E-09 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 5.02E-10 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 4.48E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 9.93E-06 1.85E-07 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 6.76E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 3.13E-06 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 1.80E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 5.36E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 6.58E-06 6.58E-06 mr1450 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 4.36E-07 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 5.51E-06 5.94E-16 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 4.32E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 2.32E-06 mr1673 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 7.77E-06 7.42E-08 mr1821 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 8.91E-13 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 1.57E-12 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 3.57E-08 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 4.93E-12 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 7.60E-06 mr1181_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 1.49E-07 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 3.48E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 3.82E-06 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 6.60E-06 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763 NA 6.47E-08 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251