Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218153763:

Variant ID: vg1218153763 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18153763
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

GTGTTGCTGACCCGGACTCCTCCGGGAATGGGGAGACCCTTCAACTGAGCATTCTCCTTCTTCAAGCGTGCTATCTTATCCTTCAGAGCTATGATCCTCA[C/T]
GAGCTTCCCGTCATTCAAGGCCTTGGACGCCTAACGCATATCTGAGTGCATCCTGTCCATTCCCCTCATTACGGCACACATGTGACCAAAGGTGGTGTCG

Reverse complement sequence

CGACACCACCTTTGGTCACATGTGTGCCGTAATGAGGGGAATGGACAGGATGCACTCAGATATGCGTTAGGCGTCCAAGGCCTTGAATGACGGGAAGCTC[G/A]
TGAGGATCATAGCTCTGAAGGATAAGATAGCACGCTTGAAGAAGGAGAATGCTCAGTTGAAGGGTCTCCCCATTCCCGGAGGAGTCCGGGTCAGCAACAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.20%	5.20%	1.18%	21.43%	NA
All Indica	2759	61.10%	4.00%	1.92%	32.98%	NA
All Japonica	1512	91.70%	7.90%	0.00%	0.33%	NA
Aus	269	64.30%	3.70%	1.12%	30.86%	NA
Indica I	595	87.90%	5.50%	0.67%	5.88%	NA
Indica II	465	46.50%	9.20%	2.37%	41.94%	NA
Indica III	913	50.40%	2.30%	2.41%	44.91%	NA
Indica Intermediate	786	62.00%	1.70%	2.04%	34.35%	NA
Temperate Japonica	767	98.70%	0.80%	0.00%	0.52%	NA
Tropical Japonica	504	80.40%	19.60%	0.00%	0.00%	NA
Japonica Intermediate	241	93.40%	6.20%	0.00%	0.41%	NA
VI/Aromatic	96	88.50%	4.20%	0.00%	7.29%	NA
Intermediate	90	90.00%	1.10%	0.00%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218153763	C -> DEL	LOC_Os12g30260.1	N	frameshift_variant	Average:54.961; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg1218153763	C -> T	LOC_Os12g30260.1	missense_variant ; p.Val193Met; MODERATE	nonsynonymous_codon ; V193M	Average:54.961; most accessible tissue: Minghui63 young leaf, score: 73.49	benign	0.408	TOLERATED	0.91

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218153763	NA	4.46E-07	mr1060	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	2.17E-09	mr1093	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	5.02E-10	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	4.48E-06	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	9.93E-06	1.85E-07	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	6.76E-07	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	3.13E-06	mr1383	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	1.80E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	5.36E-07	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	6.58E-06	6.58E-06	mr1450	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	4.36E-07	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	5.51E-06	5.94E-16	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	4.32E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	2.32E-06	mr1673	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	7.77E-06	7.42E-08	mr1821	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	8.91E-13	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	1.57E-12	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	3.57E-08	mr1093_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	4.93E-12	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	7.60E-06	mr1181_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	1.49E-07	mr1235_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	3.48E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	3.82E-06	mr1587_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	6.60E-06	mr1792_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153763	NA	6.47E-08	mr1803_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251