\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218153582:

Variant ID: vg1218153582 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18153582
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, G: 0.02, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


GACGGCTGACGCTGGAGCGAAGGAGAGAGCGGATGCGGGAGCTGACACTGGAGCAGGAGCTGGGGCTGGAGCTAGAGCTGCGGGCACTGCAGGAACTGCG[T/G]
GAGCTGCGGGAACTGCGGGCGGATGTGGGTTCCTGGGCGCGAGCTGAATGCGCACAGGTGACGTCGTCGACTTGCGGGACGTGTTGCTGACCCGGACTCC

Reverse complement sequence

GGAGTCCGGGTCAGCAACACGTCCCGCAAGTCGACGACGTCACCTGTGCGCATTCAGCTCGCGCCCAGGAACCCACATCCGCCCGCAGTTCCCGCAGCTC[A/C]
CGCAGTTCCTGCAGTGCCCGCAGCTCTAGCTCCAGCCCCAGCTCCTGCTCCAGTGTCAGCTCCCGCATCCGCTCTCTCCTTCGCTCCAGCGTCAGCCGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.20% 33.30% 0.66% 22.85% NA
All Indica  2759 59.20% 4.60% 1.09% 35.12% NA
All Japonica  1512 13.60% 86.10% 0.00% 0.33% NA
Aus  269 57.20% 8.90% 0.37% 33.46% NA
Indica I  595 87.10% 5.90% 0.17% 6.89% NA
Indica II  465 51.40% 3.90% 0.43% 44.30% NA
Indica III  913 49.80% 1.10% 0.88% 48.19% NA
Indica Intermediate  786 53.70% 8.00% 2.42% 35.88% NA
Temperate Japonica  767 1.20% 98.30% 0.00% 0.52% NA
Tropical Japonica  504 24.60% 75.40% 0.00% 0.00% NA
Japonica Intermediate  241 29.90% 69.70% 0.00% 0.41% NA
VI/Aromatic  96 22.90% 68.80% 0.00% 8.33% NA
Intermediate  90 30.00% 61.10% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218153582 T -> DEL LOC_Os12g30260.1 N frameshift_variant Average:51.759; most accessible tissue: Minghui63 young leaf, score: 74.007 N N N N
vg1218153582 T -> G LOC_Os12g30260.1 missense_variant ; p.His253Pro; MODERATE nonsynonymous_codon ; H253P Average:51.759; most accessible tissue: Minghui63 young leaf, score: 74.007 unknown unknown TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218153582 5.34E-06 NA mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 1.29E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 3.22E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 3.87E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 7.56E-06 NA mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 2.65E-06 2.65E-06 mr1299 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 1.19E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 2.19E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 2.73E-06 NA mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 7.23E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 2.98E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 5.33E-07 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 1.34E-07 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 1.32E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 2.50E-06 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 4.13E-08 NA mr1621 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 6.81E-06 mr1621 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 2.40E-11 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 7.40E-06 NA mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 3.30E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 9.65E-08 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 6.58E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 6.59E-07 mr1819 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 2.10E-10 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 4.26E-06 NA mr1876 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 2.04E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 3.39E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 9.53E-12 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 NA 8.06E-06 mr1944 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218153582 7.98E-06 NA mr1965 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251