\
| Variant ID: vg1218129212 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18129212 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.86, T: 0.14, others allele: 0.00, population size: 213. )
TAGTGAAGGCTGTCTTGGAGATATCCTCTTCCCGAATCCTCAACTGGTGGTAGCCTGATCGCAGGTCTATTTTGGAAAACACCTTGGCTCCTTTCAGCTG[T/A]
TCGAACAGATCATCAATCCGCGGTAAAGGATATTTGTTCTTGATTGTGACCTCATTGAGTGCGCGATAATCGACACACATTCTCTTCGTCTTGTCCTTCT
AGAAGGACAAGACGAAGAGAATGTGTGTCGATTATCGCGCACTCAATGAGGTCACAATCAAGAACAAATATCCTTTACCGCGGATTGATGATCTGTTCGA[A/T]
CAGCTGAAAGGAGCCAAGGTGTTTTCCAAAATAGACCTGCGATCAGGCTACCACCAGTTGAGGATTCGGGAAGAGGATATCTCCAAGACAGCCTTCACTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.40% | 33.30% | 2.92% | 20.40% | NA |
| All Indica | 2759 | 59.30% | 4.80% | 4.78% | 31.06% | NA |
| All Japonica | 1512 | 13.60% | 86.00% | 0.00% | 0.33% | NA |
| Aus | 269 | 58.70% | 8.20% | 1.12% | 31.97% | NA |
| Indica I | 595 | 87.90% | 5.40% | 0.34% | 6.39% | NA |
| Indica II | 465 | 51.60% | 3.70% | 2.58% | 42.15% | NA |
| Indica III | 913 | 50.10% | 1.60% | 9.31% | 38.99% | NA |
| Indica Intermediate | 786 | 53.10% | 8.80% | 4.20% | 33.97% | NA |
| Temperate Japonica | 767 | 1.00% | 98.40% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 24.60% | 75.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 30.70% | 68.90% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 22.90% | 68.80% | 1.04% | 7.29% | NA |
| Intermediate | 90 | 28.90% | 58.90% | 2.22% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218129212 | T -> DEL | LOC_Os12g30200.1 | N | frameshift_variant | Average:38.545; most accessible tissue: Minghui63 flag leaf, score: 65.44 | N | N | N | N |
| vg1218129212 | T -> A | LOC_Os12g30200.1 | missense_variant ; p.Glu368Asp; MODERATE | nonsynonymous_codon ; E368D | Average:38.545; most accessible tissue: Minghui63 flag leaf, score: 65.44 | benign |
-1.241 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218129212 | NA | 9.74E-08 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 5.74E-07 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | 2.31E-06 | NA | mr1230 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 1.39E-08 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 1.91E-18 | mr1304 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 3.37E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 1.06E-09 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 2.38E-15 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 2.38E-15 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 1.88E-08 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 2.88E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 7.87E-07 | mr1461 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | 7.02E-06 | NA | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 6.16E-06 | mr1602 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | 8.45E-06 | NA | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 1.30E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | 6.08E-06 | 1.38E-09 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 5.76E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 6.47E-07 | mr1819 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 8.71E-09 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 1.63E-07 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 5.69E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 3.06E-10 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 4.67E-13 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218129212 | NA | 4.31E-21 | mr1943 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |