\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218129212:

Variant ID: vg1218129212 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18129212
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.86, T: 0.14, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTGAAGGCTGTCTTGGAGATATCCTCTTCCCGAATCCTCAACTGGTGGTAGCCTGATCGCAGGTCTATTTTGGAAAACACCTTGGCTCCTTTCAGCTG[T/A]
TCGAACAGATCATCAATCCGCGGTAAAGGATATTTGTTCTTGATTGTGACCTCATTGAGTGCGCGATAATCGACACACATTCTCTTCGTCTTGTCCTTCT

Reverse complement sequence

AGAAGGACAAGACGAAGAGAATGTGTGTCGATTATCGCGCACTCAATGAGGTCACAATCAAGAACAAATATCCTTTACCGCGGATTGATGATCTGTTCGA[A/T]
CAGCTGAAAGGAGCCAAGGTGTTTTCCAAAATAGACCTGCGATCAGGCTACCACCAGTTGAGGATTCGGGAAGAGGATATCTCCAAGACAGCCTTCACTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.40% 33.30% 2.92% 20.40% NA
All Indica  2759 59.30% 4.80% 4.78% 31.06% NA
All Japonica  1512 13.60% 86.00% 0.00% 0.33% NA
Aus  269 58.70% 8.20% 1.12% 31.97% NA
Indica I  595 87.90% 5.40% 0.34% 6.39% NA
Indica II  465 51.60% 3.70% 2.58% 42.15% NA
Indica III  913 50.10% 1.60% 9.31% 38.99% NA
Indica Intermediate  786 53.10% 8.80% 4.20% 33.97% NA
Temperate Japonica  767 1.00% 98.40% 0.00% 0.52% NA
Tropical Japonica  504 24.60% 75.40% 0.00% 0.00% NA
Japonica Intermediate  241 30.70% 68.90% 0.00% 0.41% NA
VI/Aromatic  96 22.90% 68.80% 1.04% 7.29% NA
Intermediate  90 28.90% 58.90% 2.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218129212 T -> DEL LOC_Os12g30200.1 N frameshift_variant Average:38.545; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg1218129212 T -> A LOC_Os12g30200.1 missense_variant ; p.Glu368Asp; MODERATE nonsynonymous_codon ; E368D Average:38.545; most accessible tissue: Minghui63 flag leaf, score: 65.44 benign -1.241 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218129212 NA 9.74E-08 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 5.74E-07 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 2.31E-06 NA mr1230 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 1.39E-08 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 1.91E-18 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 3.37E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 1.06E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 2.38E-15 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 2.38E-15 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 1.88E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 2.88E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 7.87E-07 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 7.02E-06 NA mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 6.16E-06 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 8.45E-06 NA mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 1.30E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 6.08E-06 1.38E-09 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 5.76E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 6.47E-07 mr1819 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 8.71E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 1.63E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 5.69E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 3.06E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 4.67E-13 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212 NA 4.31E-21 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251