\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218118983:

Variant ID: vg1218118983 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18118983
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.52, T: 0.48, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAAGTTGGACACGGAAACTCATGGCTACGCTTAGGGCTGTTTGGATGGGGGACTAATCTTTAGTACCTGTCACATCAGATGTTTGGACACTGATTAAA[C/T,A]
ATAGACTAATGACAAAACTCATTTCATAACTCTGGAATAATTCGCGAGAGGAATTTGTTGAGTCTAATTAATGTAATTCACTGGGAGTACCAAGCATAGA

Reverse complement sequence

TCTATGCTTGGTACTCCCAGTGAATTACATTAATTAGACTCAACAAATTCCTCTCGCGAATTATTCCAGAGTTATGAAATGAGTTTTGTCATTAGTCTAT[G/A,T]
TTTAATCAGTGTCCAAACATCTGATGTGACAGGTACTAAAGATTAGTCCCCCATCCAAACAGCCCTAAGCGTAGCCATGAGTTTCCGTGTCCAACTTTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 40.00% 0.40% 0.00% A: 0.17%
All Indica  2759 62.90% 36.50% 0.43% 0.00% A: 0.18%
All Japonica  1512 49.40% 50.20% 0.20% 0.00% A: 0.20%
Aus  269 92.20% 7.80% 0.00% 0.00% NA
Indica I  595 90.10% 9.60% 0.17% 0.00% A: 0.17%
Indica II  465 55.30% 44.30% 0.22% 0.00% A: 0.22%
Indica III  913 52.90% 46.10% 0.77% 0.00% A: 0.22%
Indica Intermediate  786 58.40% 41.10% 0.38% 0.00% A: 0.13%
Temperate Japonica  767 63.60% 35.90% 0.26% 0.00% A: 0.26%
Tropical Japonica  504 26.20% 73.80% 0.00% 0.00% NA
Japonica Intermediate  241 52.70% 46.50% 0.41% 0.00% A: 0.41%
VI/Aromatic  96 31.20% 67.70% 1.04% 0.00% NA
Intermediate  90 55.60% 41.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218118983 C -> A LOC_Os12g30190.1 downstream_gene_variant ; 2760.0bp to feature; MODIFIER silent_mutation Average:44.237; most accessible tissue: Callus, score: 75.373 N N N N
vg1218118983 C -> A LOC_Os12g30180.1 intron_variant ; MODIFIER silent_mutation Average:44.237; most accessible tissue: Callus, score: 75.373 N N N N
vg1218118983 C -> T LOC_Os12g30190.1 downstream_gene_variant ; 2760.0bp to feature; MODIFIER silent_mutation Average:44.237; most accessible tissue: Callus, score: 75.373 N N N N
vg1218118983 C -> T LOC_Os12g30180.1 intron_variant ; MODIFIER silent_mutation Average:44.237; most accessible tissue: Callus, score: 75.373 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218118983 NA 6.26E-07 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 NA 5.51E-06 mr1046 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 NA 1.56E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 1.32E-06 9.66E-09 mr1060 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 NA 2.27E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 NA 5.97E-06 mr1171 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 NA 3.18E-09 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 NA 3.25E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 NA 9.28E-07 mr1333 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 NA 2.72E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 4.27E-06 4.26E-07 mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 NA 4.50E-07 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 NA 7.24E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 NA 9.19E-07 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 NA 4.62E-06 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 NA 4.49E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 NA 1.97E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 5.51E-06 2.30E-07 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 NA 1.51E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 5.34E-07 4.83E-09 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 NA 1.74E-07 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 NA 6.19E-06 mr1738 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 NA 2.67E-06 mr1857 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218118983 NA 1.65E-06 mr1965 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251