Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218115012:

Variant ID: vg1218115012 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18115012
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.59, A: 0.41, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:

GGAGAAATGCCCTATATAAAAGTTGTAGATCTCAATATAACTTTATAACTGACAATATTTTCATTAGAGATCGTATACATCCCCAAATATGCATTAAAGT[G/A]
ATGAGATCTATTTTTAAAAATGAAAAATTGACTTTTTCAAATGACCTCGGATGAAAACATGGTATGGATCAAAGTCGTCGTAGAGCTCAACCAGATCTAC

Reverse complement sequence

GTAGATCTGGTTGAGCTCTACGACGACTTTGATCCATACCATGTTTTCATCCGAGGTCATTTGAAAAAGTCAATTTTTCATTTTTAAAAATAGATCTCAT[C/T]
ACTTTAATGCATATTTGGGGATGTATACGATCTCTAATGAAAATATTGTCAGTTATAAAGTTATATTGAGATCTACAACTTTTATATAGGGCATTTCTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.30%	32.70%	0.59%	18.39%	NA
All Indica	2759	53.50%	44.50%	0.22%	1.81%	NA
All Japonica	1512	45.00%	5.90%	0.79%	48.35%	NA
Aus	269	29.70%	64.30%	0.74%	5.20%	NA
Indica I	595	89.10%	9.10%	0.00%	1.85%	NA
Indica II	465	46.50%	52.70%	0.22%	0.65%	NA
Indica III	913	36.90%	62.10%	0.22%	0.77%	NA
Indica Intermediate	786	50.00%	45.90%	0.38%	3.69%	NA
Temperate Japonica	767	64.00%	0.90%	1.30%	33.77%	NA
Tropical Japonica	504	23.00%	4.80%	0.20%	72.02%	NA
Japonica Intermediate	241	30.30%	24.10%	0.41%	45.23%	NA
VI/Aromatic	96	6.20%	31.20%	3.12%	59.38%	NA
Intermediate	90	47.80%	27.80%	5.56%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218115012	G -> DEL	N	N	silent_mutation	Average:27.511; most accessible tissue: Callus, score: 63.2	N	N	N	N
vg1218115012	G -> A	LOC_Os12g30180.1	upstream_gene_variant ; 896.0bp to feature; MODIFIER	silent_mutation	Average:27.511; most accessible tissue: Callus, score: 63.2	N	N	N	N
vg1218115012	G -> A	LOC_Os12g30170.1	downstream_gene_variant ; 1277.0bp to feature; MODIFIER	silent_mutation	Average:27.511; most accessible tissue: Callus, score: 63.2	N	N	N	N
vg1218115012	G -> A	LOC_Os12g30170-LOC_Os12g30180	intergenic_region ; MODIFIER	silent_mutation	Average:27.511; most accessible tissue: Callus, score: 63.2	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218115012	NA	1.69E-06	mr1035	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012	NA	1.99E-11	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012	NA	9.16E-07	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012	NA	2.56E-08	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012	NA	1.66E-06	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012	NA	6.41E-06	mr1333	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012	NA	4.59E-07	mr1335	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012	NA	8.99E-09	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012	NA	8.44E-07	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012	1.61E-06	3.21E-08	mr1577	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012	NA	9.61E-06	mr1631	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012	NA	5.74E-07	mr1660	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012	NA	8.05E-07	mr1686	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012	NA	1.13E-06	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012	NA	5.33E-06	mr1965	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012	NA	5.77E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012	NA	3.12E-06	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012	NA	1.44E-06	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012	NA	3.07E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251