\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218115012:

Variant ID: vg1218115012 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18115012
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.59, A: 0.41, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGAAATGCCCTATATAAAAGTTGTAGATCTCAATATAACTTTATAACTGACAATATTTTCATTAGAGATCGTATACATCCCCAAATATGCATTAAAGT[G/A]
ATGAGATCTATTTTTAAAAATGAAAAATTGACTTTTTCAAATGACCTCGGATGAAAACATGGTATGGATCAAAGTCGTCGTAGAGCTCAACCAGATCTAC

Reverse complement sequence

GTAGATCTGGTTGAGCTCTACGACGACTTTGATCCATACCATGTTTTCATCCGAGGTCATTTGAAAAAGTCAATTTTTCATTTTTAAAAATAGATCTCAT[C/T]
ACTTTAATGCATATTTGGGGATGTATACGATCTCTAATGAAAATATTGTCAGTTATAAAGTTATATTGAGATCTACAACTTTTATATAGGGCATTTCTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.30% 32.70% 0.59% 18.39% NA
All Indica  2759 53.50% 44.50% 0.22% 1.81% NA
All Japonica  1512 45.00% 5.90% 0.79% 48.35% NA
Aus  269 29.70% 64.30% 0.74% 5.20% NA
Indica I  595 89.10% 9.10% 0.00% 1.85% NA
Indica II  465 46.50% 52.70% 0.22% 0.65% NA
Indica III  913 36.90% 62.10% 0.22% 0.77% NA
Indica Intermediate  786 50.00% 45.90% 0.38% 3.69% NA
Temperate Japonica  767 64.00% 0.90% 1.30% 33.77% NA
Tropical Japonica  504 23.00% 4.80% 0.20% 72.02% NA
Japonica Intermediate  241 30.30% 24.10% 0.41% 45.23% NA
VI/Aromatic  96 6.20% 31.20% 3.12% 59.38% NA
Intermediate  90 47.80% 27.80% 5.56% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218115012 G -> DEL N N silent_mutation Average:27.511; most accessible tissue: Callus, score: 63.2 N N N N
vg1218115012 G -> A LOC_Os12g30180.1 upstream_gene_variant ; 896.0bp to feature; MODIFIER silent_mutation Average:27.511; most accessible tissue: Callus, score: 63.2 N N N N
vg1218115012 G -> A LOC_Os12g30170.1 downstream_gene_variant ; 1277.0bp to feature; MODIFIER silent_mutation Average:27.511; most accessible tissue: Callus, score: 63.2 N N N N
vg1218115012 G -> A LOC_Os12g30170-LOC_Os12g30180 intergenic_region ; MODIFIER silent_mutation Average:27.511; most accessible tissue: Callus, score: 63.2 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218115012 NA 1.69E-06 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012 NA 1.99E-11 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012 NA 9.16E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012 NA 2.56E-08 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012 NA 1.66E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012 NA 6.41E-06 mr1333 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012 NA 4.59E-07 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012 NA 8.99E-09 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012 NA 8.44E-07 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012 1.61E-06 3.21E-08 mr1577 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012 NA 9.61E-06 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012 NA 5.74E-07 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012 NA 8.05E-07 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012 NA 1.13E-06 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012 NA 5.33E-06 mr1965 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012 NA 5.77E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012 NA 3.12E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012 NA 1.44E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218115012 NA 3.07E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251