\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218113417:

Variant ID: vg1218113417 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18113417
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, C: 0.34, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCACCGTCGGTAGCGGCGGTGGCGCGGCATGACTACAACGAAGGATTTGGGGATTTTTGTGCTGTCCATGGCACTACTGTTGCGGAGGGGCTTGTTTG[T/C]
AAAATTGGTGCTTGTGTGGCGTGCCACGTCGGCAGTCAGAGCCGGTAAAGTGGGGTTTGGACCTCAATAAGTCACTTAAACAAGATGGTGGACATATATG

Reverse complement sequence

CATATATGTCCACCATCTTGTTTAAGTGACTTATTGAGGTCCAAACCCCACTTTACCGGCTCTGACTGCCGACGTGGCACGCCACACAAGCACCAATTTT[A/G]
CAAACAAGCCCCTCCGCAACAGTAGTGCCATGGACAGCACAAAAATCCCCAAATCCTTCGTTGTAGTCATGCCGCGCCACCGCCGCTACCGACGGTGCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.80% 18.20% 1.38% 40.65% NA
All Indica  2759 59.30% 8.10% 0.87% 31.71% NA
All Japonica  1512 13.20% 37.00% 0.60% 49.27% NA
Aus  269 3.30% 19.30% 7.81% 69.52% NA
Indica I  595 87.60% 8.40% 0.67% 3.36% NA
Indica II  465 37.40% 20.90% 0.22% 41.51% NA
Indica III  913 51.40% 3.10% 1.31% 44.25% NA
Indica Intermediate  786 60.10% 6.20% 0.89% 32.82% NA
Temperate Japonica  767 0.70% 63.60% 0.78% 34.94% NA
Tropical Japonica  504 24.60% 2.60% 0.40% 72.42% NA
Japonica Intermediate  241 29.00% 24.10% 0.41% 46.47% NA
VI/Aromatic  96 8.30% 3.10% 5.21% 83.33% NA
Intermediate  90 31.10% 24.40% 6.67% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218113417 T -> C LOC_Os12g30170.1 3_prime_UTR_variant ; 337.0bp to feature; MODIFIER silent_mutation Average:63.374; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N
vg1218113417 T -> C LOC_Os12g30180.1 upstream_gene_variant ; 2491.0bp to feature; MODIFIER silent_mutation Average:63.374; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N
vg1218113417 T -> C LOC_Os12g30160.1 downstream_gene_variant ; 3418.0bp to feature; MODIFIER silent_mutation Average:63.374; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N
vg1218113417 T -> DEL N N silent_mutation Average:63.374; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218113417 8.99E-07 8.99E-07 mr1299 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218113417 NA 9.87E-06 mr1427 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218113417 3.90E-06 3.90E-06 mr1564 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218113417 8.89E-06 2.27E-07 mr1819 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218113417 3.30E-06 3.31E-06 mr1948 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218113417 NA 7.89E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218113417 NA 1.97E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251