Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1218113417:

Variant ID: vg1218113417 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18113417
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, C: 0.34, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

CGGCACCGTCGGTAGCGGCGGTGGCGCGGCATGACTACAACGAAGGATTTGGGGATTTTTGTGCTGTCCATGGCACTACTGTTGCGGAGGGGCTTGTTTG[T/C]
AAAATTGGTGCTTGTGTGGCGTGCCACGTCGGCAGTCAGAGCCGGTAAAGTGGGGTTTGGACCTCAATAAGTCACTTAAACAAGATGGTGGACATATATG

Reverse complement sequence

CATATATGTCCACCATCTTGTTTAAGTGACTTATTGAGGTCCAAACCCCACTTTACCGGCTCTGACTGCCGACGTGGCACGCCACACAAGCACCAATTTT[A/G]
CAAACAAGCCCCTCCGCAACAGTAGTGCCATGGACAGCACAAAAATCCCCAAATCCTTCGTTGTAGTCATGCCGCGCCACCGCCGCTACCGACGGTGCCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.80%	18.20%	1.38%	40.65%	NA
All Indica	2759	59.30%	8.10%	0.87%	31.71%	NA
All Japonica	1512	13.20%	37.00%	0.60%	49.27%	NA
Aus	269	3.30%	19.30%	7.81%	69.52%	NA
Indica I	595	87.60%	8.40%	0.67%	3.36%	NA
Indica II	465	37.40%	20.90%	0.22%	41.51%	NA
Indica III	913	51.40%	3.10%	1.31%	44.25%	NA
Indica Intermediate	786	60.10%	6.20%	0.89%	32.82%	NA
Temperate Japonica	767	0.70%	63.60%	0.78%	34.94%	NA
Tropical Japonica	504	24.60%	2.60%	0.40%	72.42%	NA
Japonica Intermediate	241	29.00%	24.10%	0.41%	46.47%	NA
VI/Aromatic	96	8.30%	3.10%	5.21%	83.33%	NA
Intermediate	90	31.10%	24.40%	6.67%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218113417	T -> C	LOC_Os12g30170.1	3_prime_UTR_variant ; 337.0bp to feature; MODIFIER	silent_mutation	Average:63.374; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N
vg1218113417	T -> C	LOC_Os12g30180.1	upstream_gene_variant ; 2491.0bp to feature; MODIFIER	silent_mutation	Average:63.374; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N
vg1218113417	T -> C	LOC_Os12g30160.1	downstream_gene_variant ; 3418.0bp to feature; MODIFIER	silent_mutation	Average:63.374; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N
vg1218113417	T -> DEL	N	N	silent_mutation	Average:63.374; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218113417	8.99E-07	8.99E-07	mr1299	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218113417	NA	9.87E-06	mr1427	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218113417	3.90E-06	3.90E-06	mr1564	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218113417	8.89E-06	2.27E-07	mr1819	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218113417	3.30E-06	3.31E-06	mr1948	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218113417	NA	7.89E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218113417	NA	1.97E-07	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251