Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218112515:

Variant ID: vg1218112515 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18112515
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, T: 0.13, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

CATTTTGCTTCCCCTCTTCCTAAATCTCTCTCTCACGCGTCGGTGGCGAGCGGCGAACGGCGACGTGGAGGGGCGGGCATCGGACGGCGGCGCACGGGGA[C/T]
GGCCCCGCTGCCCTCCCACGTGGCGTCGCTGACTCTGCCCTTCCGCTCCGAGGCTACGAGACTCCATCGCTGCCACCGCGCCTAGCTCGTCGCTGTCGTC

Reverse complement sequence

GACGACAGCGACGAGCTAGGCGCGGTGGCAGCGATGGAGTCTCGTAGCCTCGGAGCGGAAGGGCAGAGTCAGCGACGCCACGTGGGAGGGCAGCGGGGCC[G/A]
TCCCCGTGCGCCGCCGTCCGATGCCCGCCCCTCCACGTCGCCGTTCGCCGCTCGCCACCGACGCGTGAGAGAGAGATTTAGGAAGAGGGGAAGCAAAATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.50%	24.70%	0.57%	1.29%	NA
All Indica	2759	87.00%	10.50%	0.54%	1.96%	NA
All Japonica	1512	49.10%	50.50%	0.33%	0.07%	NA
Aus	269	91.80%	7.10%	0.37%	0.74%	NA
Indica I	595	92.10%	7.70%	0.00%	0.17%	NA
Indica II	465	88.20%	5.40%	1.08%	5.38%	NA
Indica III	913	88.10%	9.60%	0.88%	1.42%	NA
Indica Intermediate	786	81.20%	16.70%	0.25%	1.91%	NA
Temperate Japonica	767	63.40%	36.00%	0.52%	0.13%	NA
Tropical Japonica	504	26.40%	73.40%	0.20%	0.00%	NA
Japonica Intermediate	241	51.00%	49.00%	0.00%	0.00%	NA
VI/Aromatic	96	31.20%	65.60%	1.04%	2.08%	NA
Intermediate	90	60.00%	32.20%	5.56%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218112515	C -> DEL	N	N	silent_mutation	Average:67.657; most accessible tissue: Zhenshan97 young leaf, score: 86.055	N	N	N	N
vg1218112515	C -> T	LOC_Os12g30170.1	5_prime_UTR_premature_start_codon_gain_variant ; LOW	silent_mutation	Average:67.657; most accessible tissue: Zhenshan97 young leaf, score: 86.055	N	N	N	N
vg1218112515	C -> T	LOC_Os12g30170.1	5_prime_UTR_variant ; 122.0bp to feature; MODIFIER	silent_mutation	Average:67.657; most accessible tissue: Zhenshan97 young leaf, score: 86.055	N	N	N	N
vg1218112515	C -> T	LOC_Os12g30180.1	upstream_gene_variant ; 3393.0bp to feature; MODIFIER	silent_mutation	Average:67.657; most accessible tissue: Zhenshan97 young leaf, score: 86.055	N	N	N	N
vg1218112515	C -> T	LOC_Os12g30160.1	downstream_gene_variant ; 2516.0bp to feature; MODIFIER	silent_mutation	Average:67.657; most accessible tissue: Zhenshan97 young leaf, score: 86.055	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218112515	5.85E-07	NA	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	9.74E-06	NA	mr1048	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	1.29E-07	1.69E-06	mr1060	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	1.06E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	1.55E-06	1.74E-07	mr1171	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	2.66E-06	mr1171	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	3.49E-06	1.40E-07	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	4.18E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	2.28E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	3.71E-08	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	2.11E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	4.01E-06	mr1319	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	1.17E-06	NA	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	3.14E-06	3.15E-06	mr1321	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	3.52E-06	mr1336	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	2.22E-08	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	6.61E-07	NA	mr1358	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	2.18E-06	4.55E-06	mr1359	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	1.50E-06	mr1405	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	5.42E-07	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	3.94E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	1.37E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	5.96E-06	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	5.84E-06	mr1470	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	4.70E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	2.39E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	7.75E-07	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	4.17E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	2.66E-14	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	1.28E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	5.86E-12	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	6.11E-07	NA	mr1614	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	2.35E-09	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	4.63E-09	4.15E-07	mr1621	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	9.87E-06	mr1641	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	3.25E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	5.19E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	2.38E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	1.77E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	8.02E-10	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	1.75E-06	1.75E-06	mr1779	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	3.65E-06	1.72E-08	mr1786	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	5.14E-09	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515	NA	6.21E-08	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251