\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218112515:

Variant ID: vg1218112515 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18112515
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, T: 0.13, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


CATTTTGCTTCCCCTCTTCCTAAATCTCTCTCTCACGCGTCGGTGGCGAGCGGCGAACGGCGACGTGGAGGGGCGGGCATCGGACGGCGGCGCACGGGGA[C/T]
GGCCCCGCTGCCCTCCCACGTGGCGTCGCTGACTCTGCCCTTCCGCTCCGAGGCTACGAGACTCCATCGCTGCCACCGCGCCTAGCTCGTCGCTGTCGTC

Reverse complement sequence

GACGACAGCGACGAGCTAGGCGCGGTGGCAGCGATGGAGTCTCGTAGCCTCGGAGCGGAAGGGCAGAGTCAGCGACGCCACGTGGGAGGGCAGCGGGGCC[G/A]
TCCCCGTGCGCCGCCGTCCGATGCCCGCCCCTCCACGTCGCCGTTCGCCGCTCGCCACCGACGCGTGAGAGAGAGATTTAGGAAGAGGGGAAGCAAAATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.50% 24.70% 0.57% 1.29% NA
All Indica  2759 87.00% 10.50% 0.54% 1.96% NA
All Japonica  1512 49.10% 50.50% 0.33% 0.07% NA
Aus  269 91.80% 7.10% 0.37% 0.74% NA
Indica I  595 92.10% 7.70% 0.00% 0.17% NA
Indica II  465 88.20% 5.40% 1.08% 5.38% NA
Indica III  913 88.10% 9.60% 0.88% 1.42% NA
Indica Intermediate  786 81.20% 16.70% 0.25% 1.91% NA
Temperate Japonica  767 63.40% 36.00% 0.52% 0.13% NA
Tropical Japonica  504 26.40% 73.40% 0.20% 0.00% NA
Japonica Intermediate  241 51.00% 49.00% 0.00% 0.00% NA
VI/Aromatic  96 31.20% 65.60% 1.04% 2.08% NA
Intermediate  90 60.00% 32.20% 5.56% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218112515 C -> DEL N N silent_mutation Average:67.657; most accessible tissue: Zhenshan97 young leaf, score: 86.055 N N N N
vg1218112515 C -> T LOC_Os12g30170.1 5_prime_UTR_premature_start_codon_gain_variant ; LOW silent_mutation Average:67.657; most accessible tissue: Zhenshan97 young leaf, score: 86.055 N N N N
vg1218112515 C -> T LOC_Os12g30170.1 5_prime_UTR_variant ; 122.0bp to feature; MODIFIER silent_mutation Average:67.657; most accessible tissue: Zhenshan97 young leaf, score: 86.055 N N N N
vg1218112515 C -> T LOC_Os12g30180.1 upstream_gene_variant ; 3393.0bp to feature; MODIFIER silent_mutation Average:67.657; most accessible tissue: Zhenshan97 young leaf, score: 86.055 N N N N
vg1218112515 C -> T LOC_Os12g30160.1 downstream_gene_variant ; 2516.0bp to feature; MODIFIER silent_mutation Average:67.657; most accessible tissue: Zhenshan97 young leaf, score: 86.055 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218112515 5.85E-07 NA mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 9.74E-06 NA mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 1.29E-07 1.69E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 1.06E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 1.55E-06 1.74E-07 mr1171 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 2.66E-06 mr1171 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 3.49E-06 1.40E-07 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 4.18E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 2.28E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 3.71E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 2.11E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 4.01E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 1.17E-06 NA mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 3.14E-06 3.15E-06 mr1321 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 3.52E-06 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 2.22E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 6.61E-07 NA mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 2.18E-06 4.55E-06 mr1359 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 1.50E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 5.42E-07 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 3.94E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 1.37E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 5.96E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 5.84E-06 mr1470 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 4.70E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 2.39E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 7.75E-07 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 4.17E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 2.66E-14 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 1.28E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 5.86E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 6.11E-07 NA mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 2.35E-09 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 4.63E-09 4.15E-07 mr1621 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 9.87E-06 mr1641 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 3.25E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 5.19E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 2.38E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 1.77E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 8.02E-10 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 1.75E-06 1.75E-06 mr1779 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 3.65E-06 1.72E-08 mr1786 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 5.14E-09 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218112515 NA 6.21E-08 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251