\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218108587:

Variant ID: vg1218108587 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 18108587
Reference Allele: TAlternative Allele: C,TA,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTGAGATTTAACAGTGCCATGTGGCGGTCTAGGAGTATTTATAGGAACGTCACGTGGCGGTTTGAGAGCGTTTCTAGGAAGTTTAATGGACTTTTAGTA[T/C,TA,G]
ATAATATAATATAATATAATATAATAGATAGATAGAAGATAGATAGATAGATGATATATGATGTATGCGGTGCATCGTTGAATGGATAGATAGGTTCAGA

Reverse complement sequence

TCTGAACCTATCTATCCATTCAACGATGCACCGCATACATCATATATCATCTATCTATCTATCTTCTATCTATCTATTATATTATATTATATTATATTAT[A/G,TA,C]
TACTAAAAGTCCATTAAACTTCCTAGAAACGCTCTCAAACCGCCACGTGACGTTCCTATAAATACTCCTAGACCGCCACATGGCACTGTTAAATCTCACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.00% 14.20% 17.01% 31.34% TA: 2.43%
All Indica  2759 12.40% 18.80% 20.66% 46.72% TA: 1.38%
All Japonica  1512 78.00% 4.90% 9.85% 2.45% TA: 4.83%
Aus  269 11.50% 23.80% 21.56% 43.12% NA
Indica I  595 5.70% 36.50% 32.27% 25.55% NA
Indica II  465 22.60% 3.70% 12.47% 54.41% TA: 6.88%
Indica III  913 9.70% 15.70% 14.79% 59.80% NA
Indica Intermediate  786 14.50% 18.20% 23.54% 43.00% TA: 0.76%
Temperate Japonica  767 84.70% 0.30% 12.26% 2.61% TA: 0.13%
Tropical Japonica  504 74.60% 4.40% 6.55% 1.79% TA: 12.70%
Japonica Intermediate  241 63.50% 20.70% 9.13% 3.32% TA: 3.32%
VI/Aromatic  96 56.20% 2.10% 15.62% 21.88% TA: 4.17%
Intermediate  90 53.30% 13.30% 13.33% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218108587 T -> C LOC_Os12g30160.1 upstream_gene_variant ; 285.0bp to feature; MODIFIER silent_mutation Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 N N N N
vg1218108587 T -> C LOC_Os12g30170.1 upstream_gene_variant ; 2578.0bp to feature; MODIFIER silent_mutation Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 N N N N
vg1218108587 T -> C LOC_Os12g30150-LOC_Os12g30160 intergenic_region ; MODIFIER silent_mutation Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 N N N N
vg1218108587 T -> DEL N N silent_mutation Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 N N N N
vg1218108587 T -> G LOC_Os12g30160.1 upstream_gene_variant ; 285.0bp to feature; MODIFIER N Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 N N N N
vg1218108587 T -> G LOC_Os12g30170.1 upstream_gene_variant ; 2578.0bp to feature; MODIFIER N Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 N N N N
vg1218108587 T -> G LOC_Os12g30150-LOC_Os12g30160 intergenic_region ; MODIFIER N Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 N N N N
vg1218108587 T -> TA LOC_Os12g30160.1 upstream_gene_variant ; 284.0bp to feature; MODIFIER silent_mutation Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 N N N N
vg1218108587 T -> TA LOC_Os12g30170.1 upstream_gene_variant ; 2577.0bp to feature; MODIFIER silent_mutation Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 N N N N
vg1218108587 T -> TA LOC_Os12g30150-LOC_Os12g30160 intergenic_region ; MODIFIER silent_mutation Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218108587 NA 8.57E-07 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587 NA 7.84E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587 NA 1.56E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587 NA 1.94E-06 mr1479 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587 NA 4.59E-07 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587 NA 4.17E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587 NA 6.44E-06 mr1590 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587 6.30E-06 NA mr1645 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587 1.59E-06 NA mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587 NA 1.44E-11 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587 NA 8.88E-06 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587 5.62E-07 8.96E-08 mr1755 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587 NA 1.03E-06 mr1755 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587 NA 3.96E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587 NA 1.25E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587 NA 6.81E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587 NA 2.79E-06 mr1975 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587 NA 5.61E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251