\
| Variant ID: vg1218108587 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 18108587 |
| Reference Allele: T | Alternative Allele: C,TA,G |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGTGAGATTTAACAGTGCCATGTGGCGGTCTAGGAGTATTTATAGGAACGTCACGTGGCGGTTTGAGAGCGTTTCTAGGAAGTTTAATGGACTTTTAGTA[T/C,TA,G]
ATAATATAATATAATATAATATAATAGATAGATAGAAGATAGATAGATAGATGATATATGATGTATGCGGTGCATCGTTGAATGGATAGATAGGTTCAGA
TCTGAACCTATCTATCCATTCAACGATGCACCGCATACATCATATATCATCTATCTATCTATCTTCTATCTATCTATTATATTATATTATATTATATTAT[A/G,TA,C]
TACTAAAAGTCCATTAAACTTCCTAGAAACGCTCTCAAACCGCCACGTGACGTTCCTATAAATACTCCTAGACCGCCACATGGCACTGTTAAATCTCACC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.00% | 14.20% | 17.01% | 31.34% | TA: 2.43% |
| All Indica | 2759 | 12.40% | 18.80% | 20.66% | 46.72% | TA: 1.38% |
| All Japonica | 1512 | 78.00% | 4.90% | 9.85% | 2.45% | TA: 4.83% |
| Aus | 269 | 11.50% | 23.80% | 21.56% | 43.12% | NA |
| Indica I | 595 | 5.70% | 36.50% | 32.27% | 25.55% | NA |
| Indica II | 465 | 22.60% | 3.70% | 12.47% | 54.41% | TA: 6.88% |
| Indica III | 913 | 9.70% | 15.70% | 14.79% | 59.80% | NA |
| Indica Intermediate | 786 | 14.50% | 18.20% | 23.54% | 43.00% | TA: 0.76% |
| Temperate Japonica | 767 | 84.70% | 0.30% | 12.26% | 2.61% | TA: 0.13% |
| Tropical Japonica | 504 | 74.60% | 4.40% | 6.55% | 1.79% | TA: 12.70% |
| Japonica Intermediate | 241 | 63.50% | 20.70% | 9.13% | 3.32% | TA: 3.32% |
| VI/Aromatic | 96 | 56.20% | 2.10% | 15.62% | 21.88% | TA: 4.17% |
| Intermediate | 90 | 53.30% | 13.30% | 13.33% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218108587 | T -> C | LOC_Os12g30160.1 | upstream_gene_variant ; 285.0bp to feature; MODIFIER | silent_mutation | Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 | N | N | N | N |
| vg1218108587 | T -> C | LOC_Os12g30170.1 | upstream_gene_variant ; 2578.0bp to feature; MODIFIER | silent_mutation | Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 | N | N | N | N |
| vg1218108587 | T -> C | LOC_Os12g30150-LOC_Os12g30160 | intergenic_region ; MODIFIER | silent_mutation | Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 | N | N | N | N |
| vg1218108587 | T -> DEL | N | N | silent_mutation | Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 | N | N | N | N |
| vg1218108587 | T -> G | LOC_Os12g30160.1 | upstream_gene_variant ; 285.0bp to feature; MODIFIER | N | Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 | N | N | N | N |
| vg1218108587 | T -> G | LOC_Os12g30170.1 | upstream_gene_variant ; 2578.0bp to feature; MODIFIER | N | Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 | N | N | N | N |
| vg1218108587 | T -> G | LOC_Os12g30150-LOC_Os12g30160 | intergenic_region ; MODIFIER | N | Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 | N | N | N | N |
| vg1218108587 | T -> TA | LOC_Os12g30160.1 | upstream_gene_variant ; 284.0bp to feature; MODIFIER | silent_mutation | Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 | N | N | N | N |
| vg1218108587 | T -> TA | LOC_Os12g30170.1 | upstream_gene_variant ; 2577.0bp to feature; MODIFIER | silent_mutation | Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 | N | N | N | N |
| vg1218108587 | T -> TA | LOC_Os12g30150-LOC_Os12g30160 | intergenic_region ; MODIFIER | silent_mutation | Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218108587 | NA | 8.57E-07 | mr1291 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108587 | NA | 7.84E-06 | mr1324 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108587 | NA | 1.56E-06 | mr1335 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108587 | NA | 1.94E-06 | mr1479 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108587 | NA | 4.59E-07 | mr1502 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108587 | NA | 4.17E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108587 | NA | 6.44E-06 | mr1590 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108587 | 6.30E-06 | NA | mr1645 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108587 | 1.59E-06 | NA | mr1647 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108587 | NA | 1.44E-11 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108587 | NA | 8.88E-06 | mr1660 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108587 | 5.62E-07 | 8.96E-08 | mr1755 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108587 | NA | 1.03E-06 | mr1755 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108587 | NA | 3.96E-07 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108587 | NA | 1.25E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108587 | NA | 6.81E-06 | mr1904 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108587 | NA | 2.79E-06 | mr1975 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218108587 | NA | 5.61E-06 | mr1528_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |