Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1218108587:

Variant ID: vg1218108587 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 18108587
Reference Allele: T	Alternative Allele: C,TA,G
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGTGAGATTTAACAGTGCCATGTGGCGGTCTAGGAGTATTTATAGGAACGTCACGTGGCGGTTTGAGAGCGTTTCTAGGAAGTTTAATGGACTTTTAGTA[T/C,TA,G]
ATAATATAATATAATATAATATAATAGATAGATAGAAGATAGATAGATAGATGATATATGATGTATGCGGTGCATCGTTGAATGGATAGATAGGTTCAGA

Reverse complement sequence

TCTGAACCTATCTATCCATTCAACGATGCACCGCATACATCATATATCATCTATCTATCTATCTTCTATCTATCTATTATATTATATTATATTATATTAT[A/G,TA,C]
TACTAAAAGTCCATTAAACTTCCTAGAAACGCTCTCAAACCGCCACGTGACGTTCCTATAAATACTCCTAGACCGCCACATGGCACTGTTAAATCTCACC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.00%	14.20%	17.01%	31.34%	TA: 2.43%
All Indica	2759	12.40%	18.80%	20.66%	46.72%	TA: 1.38%
All Japonica	1512	78.00%	4.90%	9.85%	2.45%	TA: 4.83%
Aus	269	11.50%	23.80%	21.56%	43.12%	NA
Indica I	595	5.70%	36.50%	32.27%	25.55%	NA
Indica II	465	22.60%	3.70%	12.47%	54.41%	TA: 6.88%
Indica III	913	9.70%	15.70%	14.79%	59.80%	NA
Indica Intermediate	786	14.50%	18.20%	23.54%	43.00%	TA: 0.76%
Temperate Japonica	767	84.70%	0.30%	12.26%	2.61%	TA: 0.13%
Tropical Japonica	504	74.60%	4.40%	6.55%	1.79%	TA: 12.70%
Japonica Intermediate	241	63.50%	20.70%	9.13%	3.32%	TA: 3.32%
VI/Aromatic	96	56.20%	2.10%	15.62%	21.88%	TA: 4.17%
Intermediate	90	53.30%	13.30%	13.33%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218108587	T -> C	LOC_Os12g30160.1	upstream_gene_variant ; 285.0bp to feature; MODIFIER	silent_mutation	Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691	N	N	N	N
vg1218108587	T -> C	LOC_Os12g30170.1	upstream_gene_variant ; 2578.0bp to feature; MODIFIER	silent_mutation	Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691	N	N	N	N
vg1218108587	T -> C	LOC_Os12g30150-LOC_Os12g30160	intergenic_region ; MODIFIER	silent_mutation	Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691	N	N	N	N
vg1218108587	T -> DEL	N	N	silent_mutation	Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691	N	N	N	N
vg1218108587	T -> G	LOC_Os12g30160.1	upstream_gene_variant ; 285.0bp to feature; MODIFIER	N	Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691	N	N	N	N
vg1218108587	T -> G	LOC_Os12g30170.1	upstream_gene_variant ; 2578.0bp to feature; MODIFIER	N	Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691	N	N	N	N
vg1218108587	T -> G	LOC_Os12g30150-LOC_Os12g30160	intergenic_region ; MODIFIER	N	Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691	N	N	N	N
vg1218108587	T -> TA	LOC_Os12g30160.1	upstream_gene_variant ; 284.0bp to feature; MODIFIER	silent_mutation	Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691	N	N	N	N
vg1218108587	T -> TA	LOC_Os12g30170.1	upstream_gene_variant ; 2577.0bp to feature; MODIFIER	silent_mutation	Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691	N	N	N	N
vg1218108587	T -> TA	LOC_Os12g30150-LOC_Os12g30160	intergenic_region ; MODIFIER	silent_mutation	Average:46.909; most accessible tissue: Zhenshan97 root, score: 71.691	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218108587	NA	8.57E-07	mr1291	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587	NA	7.84E-06	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587	NA	1.56E-06	mr1335	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587	NA	1.94E-06	mr1479	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587	NA	4.59E-07	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587	NA	4.17E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587	NA	6.44E-06	mr1590	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587	6.30E-06	NA	mr1645	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587	1.59E-06	NA	mr1647	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587	NA	1.44E-11	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587	NA	8.88E-06	mr1660	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587	5.62E-07	8.96E-08	mr1755	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587	NA	1.03E-06	mr1755	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587	NA	3.96E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587	NA	1.25E-06	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587	NA	6.81E-06	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587	NA	2.79E-06	mr1975	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218108587	NA	5.61E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251